ID: 1144200286

View in Genome Browser
Species Human (GRCh38)
Location 17:12934868-12934890
Sequence CAGGAGTACCACAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144200281_1144200286 -4 Left 1144200281 17:12934849-12934871 CCTTCCTTGGCGTGTCAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 242
1144200279_1144200286 8 Left 1144200279 17:12934837-12934859 CCTGGGCTGGGACCTTCCTTGGC 0: 1
1: 0
2: 3
3: 34
4: 305
Right 1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 242
1144200283_1144200286 -8 Left 1144200283 17:12934853-12934875 CCTTGGCGTGTCAGGCAGGAGTA 0: 1
1: 0
2: 0
3: 13
4: 104
Right 1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144200286 Original CRISPR CAGGAGTACCACAAGGAGGC TGG Intronic
900347094 1:2215105-2215127 CGGGAGTCCCACTAGGAGGAGGG + Intergenic
900938755 1:5784189-5784211 GGGAAGTACCACAAGGAGACAGG + Intergenic
901536066 1:9883667-9883689 CAGGAGGACCATGAGGAGGGAGG - Intronic
902527898 1:17071227-17071249 CAGGAGCAAAGCAAGGAGGCTGG + Intronic
903930339 1:26858331-26858353 CATCAGTAAAACAAGGAGGCTGG - Intergenic
906014133 1:42558671-42558693 TTGGAGTACCAGAAGGAGACGGG + Intronic
906118584 1:43372127-43372149 CAGGAGAACCACTTGAAGGCAGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
909712833 1:78672434-78672456 CAGGAGTACAAATAGGAGGCAGG - Intergenic
910351786 1:86307051-86307073 CAGGAGTACTGGAAGGAGGCTGG - Intergenic
910444033 1:87282519-87282541 CAGGAGCAACATAAGGAAGCTGG + Intergenic
910777895 1:90893900-90893922 CAGGAGTCACACGTGGAGGCCGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
912430107 1:109624434-109624456 CATCTGTACCACGAGGAGGCTGG - Intronic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
917279515 1:173367821-173367843 CAGGTGTAGGTCAAGGAGGCAGG - Intergenic
918156371 1:181850628-181850650 TTGGAGTACCAGAAGGAGACAGG + Intergenic
918315513 1:183319484-183319506 CAGGAGAGTCACAAGCAGGCTGG + Intronic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
919586471 1:199446749-199446771 TTGGAGTACCAGAAGGAGACGGG - Intergenic
922007277 1:221544417-221544439 CAGGAGGACCACATGAAGTCTGG + Intergenic
922096534 1:222447744-222447766 CAGCAGAACCACAGGGAGTCTGG - Intergenic
922926072 1:229347642-229347664 CAGGAGAACCACAGGGGGACAGG - Intergenic
923357375 1:233172699-233172721 CAGGAGTACCTGGAGGAAGCAGG - Intronic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
1062906975 10:1185951-1185973 CAGGAGCACCTCAAGGAGTCAGG - Intronic
1063759447 10:9056769-9056791 CAGGAGCACCACATGCAGCCTGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1067203376 10:44193989-44194011 CTGGGGGGCCACAAGGAGGCAGG + Intergenic
1068126726 10:52850229-52850251 TTGGAGTACCAGAAGGAGACGGG - Intergenic
1070360126 10:75680254-75680276 CAGGAGTAACAGTAGGATGCTGG + Intronic
1070807126 10:79277174-79277196 CAGGAGGACAACAAGGCTGCAGG - Exonic
1072855750 10:98944261-98944283 CAAGAGGACAGCAAGGAGGCAGG + Intronic
1073794651 10:106974535-106974557 CAAGAGATCCACAAGGATGCAGG + Intronic
1075115574 10:119623843-119623865 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1076353175 10:129832568-129832590 CAGGAGACCCACTGGGAGGCTGG + Intergenic
1076750471 10:132539591-132539613 CAGGAGTACCAACAGCAGGGTGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1080046293 11:27812000-27812022 CTAGAGTCCCCCAAGGAGGCTGG + Intergenic
1080164737 11:29223571-29223593 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1081454802 11:43211311-43211333 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1081744258 11:45462012-45462034 CAGTAGAACCCCCAGGAGGCAGG - Intergenic
1081991733 11:47341601-47341623 CAGGAGGCCACCAAGGAGGCCGG - Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1084287299 11:68140589-68140611 AAGGAGGAGCTCAAGGAGGCAGG + Intergenic
1084761259 11:71272597-71272619 CAGGCCTAACTCAAGGAGGCAGG + Intergenic
1086771531 11:90773755-90773777 CTGGAGTACCAGAAGGAAACAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1091895784 12:4103129-4103151 GAGGATTACCACAAAGGGGCAGG - Intergenic
1092639942 12:10494773-10494795 TTGGAGTACCAGAAGGAGACGGG + Intergenic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1104256238 12:127141916-127141938 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1104593563 12:130104082-130104104 CAGGAGGACCCGAAGGAGCCAGG - Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1110402501 13:75110014-75110036 TGGGAGTACCAGAAGGAGACGGG + Intergenic
1111854825 13:93624531-93624553 GAGGAAAACCACAAGGATGCTGG - Intronic
1112505684 13:99974095-99974117 CAAGAGTTGTACAAGGAGGCGGG - Intergenic
1114376241 14:22149323-22149345 CTGGAGTACTACAAGAAAGCTGG - Intergenic
1115848472 14:37565761-37565783 GAGGAACACCACAAGGGGGCAGG - Intergenic
1116560767 14:46376210-46376232 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1116881865 14:50178573-50178595 CAGGAGGATCACTTGGAGGCAGG - Intronic
1118192720 14:63594844-63594866 CAGCAGGACCTCAAAGAGGCCGG + Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119735291 14:76977694-76977716 TAGGAGTGTCACAAGGAGCCTGG + Intergenic
1121636997 14:95460800-95460822 CAGGAGTAACAGACAGAGGCTGG + Intronic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1127932597 15:63606848-63606870 CAGGAGGACCCCCAGAAGGCTGG - Intergenic
1129188787 15:73926069-73926091 CGGGAGTACGGGAAGGAGGCTGG + Intronic
1130644847 15:85715317-85715339 CATGAGTATCACAAGAAGACTGG - Intronic
1130934214 15:88455175-88455197 CATGAGCACCACAAGGTGGCAGG - Intergenic
1132602195 16:778371-778393 CGGGAGGTCCACCAGGAGGCAGG - Intronic
1132781334 16:1627763-1627785 CTAGAGTACAGCAAGGAGGCTGG + Intronic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1136276712 16:29183155-29183177 CAGGAATAGCACAAAGAAGCGGG - Intergenic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1138747281 16:59378035-59378057 GAGGAGTAGCTCCAGGAGGCAGG - Intergenic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1140112881 16:72018594-72018616 CAGGAGGGCCACAGGGAGGGAGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1145025805 17:19467049-19467071 CAGGAGTTCCACAGGCTGGCTGG - Intergenic
1145035886 17:19540287-19540309 CAGGTGGCCCACAGGGAGGCAGG + Intronic
1146969070 17:37057703-37057725 CAGAAAAACCACAACGAGGCCGG - Intergenic
1147180878 17:38684941-38684963 CAGGAGTATACAAAGGAGGCAGG + Intergenic
1147838173 17:43350015-43350037 CATGAGGACAACATGGAGGCTGG - Intergenic
1148558828 17:48594435-48594457 CAGCAGTTCCACCAGGATGCAGG - Intronic
1149443591 17:56696305-56696327 CAGGTGTGCCACCAGGAAGCTGG - Intergenic
1154273551 18:12940393-12940415 CAGGAGCTCCTCAAGGATGCAGG + Intergenic
1161645955 19:5453580-5453602 CAGGAGTGCCACCAGGGGCCGGG + Intergenic
1161979807 19:7624515-7624537 CAGGGGTTCCACATTGAGGCTGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1166012219 19:39950974-39950996 CAGGAGTACAACAACGAGTTAGG + Intergenic
1167255787 19:48427766-48427788 CAGGAGTAGACCAAGGAGGGTGG - Intronic
925188215 2:1864001-1864023 CAGGAGCATCACAAGGTGGCTGG + Intronic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
925447338 2:3939487-3939509 TTGGAGTACCAGAAGGAGACAGG - Intergenic
926991203 2:18682424-18682446 CAGGAGGAACACAAAGAGACTGG + Intergenic
927154585 2:20214099-20214121 CAGGATTACAACAGAGAGGCTGG + Intronic
927168832 2:20351238-20351260 CAGGAGTACCCCACGGTGGGCGG - Intronic
929802666 2:45117591-45117613 CAGGACTCCTACAAGCAGGCTGG + Intergenic
929815062 2:45223832-45223854 CAGGAGAACCTCAGGGAGACTGG + Intergenic
929878481 2:45816541-45816563 CAGGAGTTTCACAAGAAGTCTGG - Intronic
930031486 2:47060786-47060808 CAGCAGCACCTCAAGGAAGCAGG + Exonic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931270047 2:60693570-60693592 CAGGAGCACCCACAGGAGGCAGG + Intergenic
931998507 2:67862038-67862060 CTGGTATACCCCAAGGAGGCTGG + Intergenic
932857507 2:75252259-75252281 CAGGAGTACCTCAAGGACTCTGG + Intergenic
933525742 2:83436244-83436266 CAGGAGTACCACTTGAAGTCAGG + Intergenic
934764656 2:96873960-96873982 CACCAGTACCAAAAGGAAGCAGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935269700 2:101423343-101423365 CATGAGTGACACAGGGAGGCAGG - Intronic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
935945953 2:108286951-108286973 CAGGAGTAAACCAGGGAGGCAGG + Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
939177772 2:138769592-138769614 AAGGAGAACCACACGCAGGCAGG + Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
941437817 2:165493160-165493182 CATGAGTGGCACAAGGAGGGTGG + Intronic
942579498 2:177402322-177402344 CAGGAAAGCCACAAGGAGACTGG + Intronic
945431482 2:209771060-209771082 TAGGAGTAAAACAAGTAGGCCGG - Intergenic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
1169479166 20:5962066-5962088 CTGGAGTACAGCAAGGTGGCTGG + Intronic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1179538730 21:42070023-42070045 CAAGAATACAAAAAGGAGGCTGG - Intronic
1180595490 22:16970237-16970259 CAGGACTGCCCCAGGGAGGCAGG + Intronic
1180744539 22:18078501-18078523 CAGGTGCACCACCAGGAGGTCGG - Exonic
1180859150 22:19067165-19067187 GAGGAGTAACACAAGCAGACAGG + Intronic
1181457641 22:23068832-23068854 CAGGAGGACCACACAGAGACCGG - Intronic
1182938791 22:34254062-34254084 CTGGAGTACCAAAAGGAGATGGG - Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1185202289 22:49514946-49514968 AAGGAGTACCAGCAGCAGGCGGG + Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949466066 3:4345059-4345081 TTGGAGTACCAGAAGGAGACAGG + Intronic
951576982 3:24123934-24123956 AAGGGGTGACACAAGGAGGCTGG + Intronic
951627688 3:24683964-24683986 CAGAAGTACCACCAGATGGCAGG - Intergenic
951914082 3:27781140-27781162 CAAGAGAAGCACAAGGAGACAGG + Intergenic
951954961 3:28243350-28243372 CAGAAGTACCATAATTAGGCTGG - Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954237073 3:49265104-49265126 CAGAAGTACCACTCTGAGGCTGG + Intergenic
954405498 3:50342949-50342971 CAGCAGTTCCACCAGGAGGCAGG + Exonic
954438876 3:50510811-50510833 CAGCACCACCCCAAGGAGGCAGG - Intergenic
954827139 3:53383970-53383992 CAGGAGTAGCACTACCAGGCAGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956738216 3:72255452-72255474 CAGGAGCCCCACAAGGAAGGGGG + Intergenic
958073092 3:88640006-88640028 TTGGAGTACCAGAAGGAGACAGG - Intergenic
958503594 3:94945507-94945529 CTGGAGTACCGGAAGGAGACGGG - Intergenic
958656326 3:97008221-97008243 TTGGAGTACCAGAAGGAGACAGG - Intronic
959205689 3:103303803-103303825 TTGGAGTACCAGAAGGAGACAGG - Intergenic
962692098 3:137908819-137908841 TTGGAGTACCAGAAGGAGACCGG + Intergenic
968519252 4:1028328-1028350 CAGGGGGACCCCAAGGAGTCAGG + Intergenic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
969283394 4:6186715-6186737 CAGGAGGTCAACAAGGAAGCAGG - Intronic
969477042 4:7427705-7427727 CAGGAGTGTCACATGGAGGCAGG + Intronic
969725026 4:8913681-8913703 CCGGAGTGCCCCAAGGATGCCGG + Intergenic
969973607 4:11073995-11074017 AAGGAATAGCACAGGGAGGCTGG - Intergenic
970952586 4:21774553-21774575 GTGGAGTACCAGAAGGAGACAGG - Intronic
974768815 4:66384067-66384089 TTGGAGTACCAGAAGGAGACTGG + Intergenic
975555015 4:75654027-75654049 AAACAGTACCACTAGGAGGCAGG + Exonic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978206325 4:106084462-106084484 CCGGAGTACCAGAAGGAGACAGG + Intronic
978313902 4:107414925-107414947 AAGAGGTACCACAAGGAGGGGGG + Intergenic
983727088 4:170941790-170941812 CCGGAGTACCACAAGGAGCCAGG + Intergenic
984092197 4:175387879-175387901 CAGGTGTCACTCAAGGAGGCTGG - Intergenic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
984616773 4:181907246-181907268 CAGGAGTGCAACAGGGAGCCAGG + Intergenic
985047114 4:185951636-185951658 CAGCAGTACCATAAGGTGCCAGG + Intronic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
989615651 5:43334805-43334827 AAGAGGTACCACAAGGAGGGGGG - Intergenic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992842756 5:80712124-80712146 CTGGTGTTCCACAAGGTGGCAGG + Intronic
993436493 5:87901939-87901961 CAGGAGAACCAGAAGAATGCAGG - Intergenic
994414525 5:99451654-99451676 AGGGGGTAGCACAAGGAGGCGGG - Intergenic
996893992 5:128457327-128457349 CTGGAGTACCAGGAGGAGACAGG + Intronic
996965701 5:129305325-129305347 TTGGAGTACCTGAAGGAGGCGGG - Intergenic
998449455 5:142222951-142222973 AAGGGGTACCCCAAGGAGGTGGG + Intergenic
998963033 5:147509197-147509219 CAGGAGTGCGGCGAGGAGGCAGG + Intronic
999309826 5:150544892-150544914 CAGGACTGCCCCAGGGAGGCTGG - Intronic
999774272 5:154799738-154799760 CAGCACTACCAAAAGGAGACAGG + Exonic
1003526972 6:6906226-6906248 CTGGAGAACCACAAGGGAGCAGG - Intergenic
1003584284 6:7372560-7372582 CAAAAGAACCACAAGAAGGCAGG + Intronic
1005690552 6:28300736-28300758 TAGGAGTACTACAAGGAATCTGG - Exonic
1006220845 6:32489813-32489835 CAAGTGTACCACAATGATGCAGG - Intergenic
1008468095 6:51853539-51853561 TTGGAGTACCAGAAGGAGACAGG - Intronic
1010128630 6:72465195-72465217 CAGGAGCACCACGAGAATGCAGG + Intergenic
1010732770 6:79408790-79408812 CAGGGCTATCACAAGGAGCCAGG - Intergenic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1012396009 6:98797960-98797982 CAGGAATGCAACAATGAGGCAGG + Intergenic
1014367396 6:120561821-120561843 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1015198168 6:130547274-130547296 AAGGAATAACACAAGGAAGCTGG - Intergenic
1015554265 6:134444546-134444568 TATGAAAACCACAAGGAGGCTGG - Intergenic
1018358801 6:163045027-163045049 CTGGAGTATCTCAAGGAGGTAGG + Intronic
1019016730 6:168885431-168885453 CAGGAGGACCACCAGGGGCCAGG - Intergenic
1020101777 7:5397828-5397850 CATGAAATCCACAAGGAGGCTGG - Intronic
1020621948 7:10529134-10529156 TTGGAGTACCAGAAGGAGACAGG + Intergenic
1022270855 7:28806634-28806656 CAGGAGGAGCACAAGAAGCCAGG - Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1023843041 7:44107408-44107430 CAGGAGTTCCAGAAGCAGGTGGG - Intronic
1024554527 7:50592087-50592109 CAGGTGTGTCTCAAGGAGGCTGG + Exonic
1026580927 7:71615956-71615978 CAGGTGTAGCACAAGGCAGCAGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026888406 7:73967947-73967969 CAGGAGACCCACCTGGAGGCTGG - Intergenic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1031804741 7:126293884-126293906 TTGGAGTACCAAAAGGAGACAGG + Intergenic
1034232627 7:149543838-149543860 CAGGAGTGCCATAAGAAAGCTGG - Intergenic
1035038650 7:155911658-155911680 CTGGATCACCACAGGGAGGCCGG + Intergenic
1035491845 7:159286049-159286071 TTGGAGTACCAGAAGGAGACAGG + Intergenic
1035599332 8:887992-888014 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1038685952 8:29718710-29718732 CTGGACTCCCACAAGGAGGCCGG + Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1041613697 8:59881599-59881621 CAGGAGGAGCCCAAGGAGACAGG + Intergenic
1043223757 8:77699035-77699057 CAGATGTCCCTCAAGGAGGCTGG + Intergenic
1044355993 8:91223791-91223813 TTGGAGTACCAGAAGGAGACAGG - Intronic
1045593005 8:103619608-103619630 CAGAACTACAAAAAGGAGGCAGG + Intronic
1047090148 8:121565494-121565516 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1047347924 8:124046653-124046675 CAGGAGTACTGCGAGGAGGTGGG - Intronic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1048766608 8:137851605-137851627 GAGGGCTACCACAAGGAGTCTGG - Intergenic
1049164149 8:141116325-141116347 CAGCAGTGGCACAAGGAGGCTGG + Intergenic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1051038291 9:12775911-12775933 GAGGAGGACGACAAGGAGGGAGG - Exonic
1051631737 9:19147182-19147204 CAGAACTATCACAAGGAGTCCGG - Intronic
1052225130 9:26076747-26076769 TTGGAGTACCATAAGGAGACAGG - Intergenic
1054934086 9:70668319-70668341 CACAAGTACCACAATGGGGCAGG - Intronic
1055570938 9:77616462-77616484 CAGGAGTACCACCAGAAGCAAGG + Intronic
1056095385 9:83248104-83248126 CAGGCCCACCACAAGGAGCCTGG + Exonic
1057490948 9:95518964-95518986 CAGGAGTGGCATAATGAGGCAGG + Intergenic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1059746064 9:117202951-117202973 TTGGAGTACCAGAAGGAGACAGG - Intronic
1060325415 9:122609863-122609885 CAGAAGCACCACCAGGAGTCTGG + Intergenic
1060446494 9:123693425-123693447 AAGGAGCAACACAAGCAGGCTGG - Intronic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1186470334 X:9816526-9816548 CACAAGGACCACAAGGATGCCGG - Intronic
1186536807 X:10358545-10358567 CAGGTGTAATACAAGGAGACAGG + Intergenic
1187084657 X:16029440-16029462 AAGCAGTACCTCAAGGAGCCAGG - Intergenic
1187960981 X:24565600-24565622 CTAGAGCACCACAAGGAGACTGG + Intronic
1189298426 X:39935424-39935446 CAGGAGGCCCACCAGCAGGCAGG - Intergenic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1192624561 X:72714168-72714190 CAGGAGTCACACGCGGAGGCCGG - Intronic
1192716590 X:73648740-73648762 CTGGAGTACCCGAAGGAGACGGG + Intronic
1193780652 X:85697808-85697830 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1197435249 X:126420094-126420116 CAGGAGGATCACCTGGAGGCAGG - Intergenic
1199637467 X:149826914-149826936 AAGAGGTACCACAAGGAGGGTGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1201685902 Y:16702207-16702229 CAAAAGTACCACAAGCAGGATGG + Intergenic