ID: 1144201972

View in Genome Browser
Species Human (GRCh38)
Location 17:12949719-12949741
Sequence GGGGTACTCACTTGGAAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144201972_1144201979 14 Left 1144201972 17:12949719-12949741 CCAGGCTTCCAAGTGAGTACCCC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1144201979 17:12949756-12949778 CCTGTGAGTTACAGTTTATTTGG 0: 1
1: 1
2: 1
3: 10
4: 205
1144201972_1144201980 15 Left 1144201972 17:12949719-12949741 CCAGGCTTCCAAGTGAGTACCCC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1144201980 17:12949757-12949779 CTGTGAGTTACAGTTTATTTGGG 0: 1
1: 0
2: 1
3: 15
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144201972 Original CRISPR GGGGTACTCACTTGGAAGCC TGG (reversed) Exonic
902166898 1:14579785-14579807 GGGGGACTCACATGGCAGCCAGG + Intergenic
902651319 1:17839452-17839474 GGTGTCCTCACTTGGTAGCTGGG - Intergenic
903343045 1:22666684-22666706 GGAGTACTGACTTGGGAGTCAGG - Intergenic
904525077 1:31127452-31127474 AAGCTAATCACTTGGAAGCCAGG + Intergenic
904623565 1:31789576-31789598 GAGGTTCTCTCCTGGAAGCCAGG + Intergenic
905673458 1:39808304-39808326 GGGCTCCTCACTTGGCAGACGGG - Intergenic
917797520 1:178542714-178542736 GGGGTACTGACTGGGCAGCGCGG - Intronic
920446480 1:206022318-206022340 AGGGTGCTCACCAGGAAGCCAGG + Intronic
922864536 1:228848350-228848372 GGGGTACTCAGCAGGCAGCCTGG - Intergenic
923322362 1:232847402-232847424 GTGGTACACACTTGGAAGAGGGG + Intergenic
924270789 1:242330402-242330424 GTGGCCCTTACTTGGAAGCCTGG + Intronic
1063373011 10:5533836-5533858 GGGAAACTCATTAGGAAGCCTGG + Intergenic
1068789459 10:61011094-61011116 AAGGTAGTCACTTGCAAGCCAGG + Intergenic
1068838824 10:61587529-61587551 GGGGAACAGAATTGGAAGCCAGG + Intergenic
1074768703 10:116719311-116719333 AGGGTACTCACTTAAAAGGCGGG - Intronic
1075579892 10:123609468-123609490 TGGGTACTCACACGAAAGCCTGG - Intergenic
1079967167 11:26994029-26994051 GGTTTCGTCACTTGGAAGCCAGG - Intergenic
1085023293 11:73222240-73222262 TGGGCACTCACCAGGAAGCCAGG - Intronic
1098137627 12:67419451-67419473 GGGGAACTCTTGTGGAAGCCAGG + Intergenic
1099825437 12:87771114-87771136 GGCTTATTCTCTTGGAAGCCAGG + Intergenic
1101818127 12:108161664-108161686 GTGGTACTCTGTTGGCAGCCCGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104021708 12:124996455-124996477 GTGGTGCTCACTTGTAATCCCGG - Intronic
1104420796 12:128633142-128633164 GAGGAACTCACTTGCCAGCCAGG - Intronic
1112975806 13:105315488-105315510 GGGATACTCCCTTGGGAACCCGG + Intergenic
1113393058 13:109916353-109916375 GGTGTAGTCACTCTGAAGCCTGG - Intergenic
1116336902 14:43667759-43667781 GTGGTACACACTTGTAATCCTGG + Intergenic
1120731591 14:88008917-88008939 GGGGTCCTCACTTGGAAACTAGG - Intronic
1124146124 15:27126932-27126954 GGGGCAATAACTTGGAAGGCAGG + Intronic
1126140155 15:45430644-45430666 GGGAGACTCACCTGGACGCCGGG - Exonic
1127268833 15:57382794-57382816 GGGGTCCTCACTTGGAAAATGGG - Intronic
1135752839 16:25070683-25070705 CTGGTACTCATTTGGAGGCCCGG + Intergenic
1138488041 16:57359238-57359260 GGGGTTCTCCCTTGGAAAGCTGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1147251279 17:39153935-39153957 GAATTACTCACTTGGAAGCAGGG + Intronic
1147832918 17:43309763-43309785 AGTGTGGTCACTTGGAAGCCTGG + Intergenic
1149500471 17:57148558-57148580 GGGGTACTGACTTTGAAGGGGGG - Intergenic
1152574783 17:81135231-81135253 GGTGTCCTGATTTGGAAGCCGGG - Intronic
1158309627 18:56144336-56144358 GGGGTATTGACATTGAAGCCTGG + Intergenic
1159692375 18:71504913-71504935 GGGCCACTCTCATGGAAGCCAGG - Intergenic
1160022528 18:75191502-75191524 GGGGTCCTCACATGTGAGCCAGG + Intergenic
1162261764 19:9539794-9539816 GGGGGACTCCCTTGGGAGACTGG + Intergenic
1163105543 19:15121015-15121037 GAGGGACTGACTGGGAAGCCAGG + Intronic
1168104568 19:54158799-54158821 GGGGTAGTCACTTGGAGCCATGG - Intronic
935648746 2:105363955-105363977 GGAGTCCTTACTTAGAAGCCTGG + Intronic
942593633 2:177571606-177571628 AAGGTACTCACCTGCAAGCCAGG + Intergenic
942681143 2:178479546-178479568 TGGGTATTCACTTGGAAACAAGG - Intergenic
946650964 2:221892268-221892290 GGGGTTCTCACTTAGACGTCAGG - Intergenic
1169122485 20:3105731-3105753 GTGGTGCTCACTTGATAGCCGGG + Intergenic
1170710011 20:18781962-18781984 GGGGTGCTCACTTGGATCTCTGG + Intergenic
1171970704 20:31563228-31563250 GAGGTACCCACTTGGATGACTGG - Intronic
1172132521 20:32665058-32665080 GGGGAACTTACTTGGCAGCTTGG - Intergenic
1175177891 20:57124417-57124439 GTGGAAGTCACTTCGAAGCCTGG - Intergenic
1176120757 20:63453557-63453579 GGGCTCCTGACTGGGAAGCCAGG - Intronic
1178467733 21:32863905-32863927 GGGGGTCACACTTGTAAGCCGGG + Intergenic
1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG + Exonic
1184205558 22:43000224-43000246 GGGGTCCTGACCTGGAACCCGGG - Intronic
1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG + Intronic
953658245 3:44871157-44871179 AGGGTGCTCAGGTGGAAGCCTGG - Intronic
954450958 3:50571524-50571546 GGGATAGACACCTGGAAGCCTGG + Intronic
957440130 3:80234741-80234763 GCTTTACTCATTTGGAAGCCTGG - Intergenic
958893842 3:99808690-99808712 GGGATGCTCACTTGGAACCCAGG - Intergenic
968810997 4:2799661-2799683 GGGGGACCCACTTGGGACCCAGG + Intronic
969435395 4:7186340-7186362 GTGGCAGGCACTTGGAAGCCAGG - Intergenic
972599819 4:40562259-40562281 GTGGTCCTCTTTTGGAAGCCTGG + Intronic
981573397 4:146177228-146177250 AGAGTACTCACTTGGGAGGCAGG - Intronic
984012579 4:174388345-174388367 GGTGTCCTCACATGGAAACCAGG - Intergenic
985589646 5:757872-757894 GGGGGACTCACATGGGGGCCAGG + Intronic
988421833 5:31015263-31015285 TGGCTCCTCAGTTGGAAGCCAGG + Intergenic
997234566 5:132265398-132265420 AGGGTACCCACTTGGGAGCCTGG + Intronic
997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG + Intergenic
1009616861 6:66020356-66020378 GTGATAGTCACTTGCAAGCCTGG - Intergenic
1009721524 6:67476788-67476810 GGGGTACTTACTTGGCAGTTTGG + Intergenic
1018239732 6:161761612-161761634 GGTTTTCTTACTTGGAAGCCAGG - Intronic
1019348764 7:543370-543392 GGGTGACTCACTTTGAGGCCAGG - Intergenic
1022078076 7:26993129-26993151 GGGGTGCTCTCTTGGAGGCTAGG - Intronic
1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG + Intronic
1022446351 7:30473785-30473807 GGGGTACTCACTGAGCAGCTGGG + Intronic
1023899878 7:44467487-44467509 TGGGTTCTAACTTGGCAGCCTGG - Intronic
1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG + Intronic
1025611171 7:63076866-63076888 GGGGAAGCCACATGGAAGCCAGG - Intergenic
1029419671 7:100466232-100466254 AGGGGACACACTGGGAAGCCAGG + Intronic
1032468528 7:132161830-132161852 TGGGTACCCACGTGGGAGCCTGG - Intronic
1037848108 8:22302599-22302621 GGGGTGATCACTAGGAAGCCAGG - Intronic
1038489809 8:27962648-27962670 GGGATACTCAGTTCAAAGCCAGG + Intronic
1043609960 8:82050316-82050338 AGGTTATTCCCTTGGAAGCCAGG - Intergenic
1045035516 8:98173550-98173572 GGGGTCTTCCCTTGGAATCCAGG + Intergenic
1045823335 8:106367909-106367931 GGGGAACTGTCTAGGAAGCCAGG + Intronic
1053479284 9:38404019-38404041 GGGGTTTTCACTTGGATCCCTGG - Intergenic
1057974743 9:99593457-99593479 GAGGTACTCTGTTGGAAGGCTGG - Intergenic
1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG + Intergenic
1194866541 X:99075750-99075772 GGGTCTCTCACTTGGAAGTCTGG - Intergenic