ID: 1144201979

View in Genome Browser
Species Human (GRCh38)
Location 17:12949756-12949778
Sequence CCTGTGAGTTACAGTTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144201976_1144201979 -6 Left 1144201976 17:12949739-12949761 CCCTTGTTTTGGAATGTCCTGTG 0: 1
1: 0
2: 0
3: 28
4: 258
Right 1144201979 17:12949756-12949778 CCTGTGAGTTACAGTTTATTTGG 0: 1
1: 1
2: 1
3: 10
4: 205
1144201975_1144201979 -5 Left 1144201975 17:12949738-12949760 CCCCTTGTTTTGGAATGTCCTGT 0: 1
1: 1
2: 1
3: 20
4: 264
Right 1144201979 17:12949756-12949778 CCTGTGAGTTACAGTTTATTTGG 0: 1
1: 1
2: 1
3: 10
4: 205
1144201972_1144201979 14 Left 1144201972 17:12949719-12949741 CCAGGCTTCCAAGTGAGTACCCC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1144201979 17:12949756-12949778 CCTGTGAGTTACAGTTTATTTGG 0: 1
1: 1
2: 1
3: 10
4: 205
1144201977_1144201979 -7 Left 1144201977 17:12949740-12949762 CCTTGTTTTGGAATGTCCTGTGA 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1144201979 17:12949756-12949778 CCTGTGAGTTACAGTTTATTTGG 0: 1
1: 1
2: 1
3: 10
4: 205
1144201973_1144201979 6 Left 1144201973 17:12949727-12949749 CCAAGTGAGTACCCCTTGTTTTG 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1144201979 17:12949756-12949778 CCTGTGAGTTACAGTTTATTTGG 0: 1
1: 1
2: 1
3: 10
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144201979 Original CRISPR CCTGTGAGTTACAGTTTATT TGG Intronic
900983177 1:6058253-6058275 CCTGTGAGTGTGACTTTATTTGG - Intronic
902210117 1:14898956-14898978 CCTGTGAATGACAATGTATTTGG + Intronic
902550294 1:17215179-17215201 CCTGTGAGTAACAGATGAGTGGG - Intronic
905537393 1:38733485-38733507 CCTTTGCGTTACAGTTTGTATGG + Intergenic
906537525 1:46559951-46559973 GCTGTAAGTTACAGTTCAATGGG + Intronic
907730126 1:57057938-57057960 CCTGTAACTTACAGAATATTAGG - Intronic
908668586 1:66520307-66520329 CTTGAGACTTACAGTTTAGTAGG + Intergenic
909938090 1:81577621-81577643 CCTGTGAGTGACATTTGGTTTGG - Intronic
910092921 1:83486765-83486787 CCTGAGACTTCCTGTTTATTGGG - Intergenic
910728871 1:90368956-90368978 CCTGTAAGTGCCAGTTTACTGGG + Intergenic
911068754 1:93815074-93815096 CCACAGAGCTACAGTTTATTGGG + Intronic
912064893 1:105725493-105725515 CCTGTCAGTTACATTATATCTGG - Intergenic
913086409 1:115441512-115441534 CCTGTGATTAACAGTCTGTTTGG - Intergenic
917680006 1:177355937-177355959 CCTGTGAATGCTAGTTTATTTGG + Intergenic
922251591 1:223854069-223854091 CCTGTGGGTTACAGTATTGTGGG - Intergenic
922365072 1:224855862-224855884 CCTATTAATTAAAGTTTATTTGG - Intergenic
922439226 1:225638485-225638507 CCTTAGACTTACAGTTTAGTGGG - Intronic
1062830953 10:605489-605511 TGTGTGAGTAACAGTTTATGTGG - Intronic
1071893447 10:90038278-90038300 CCTGTGGTTTACAGTCTAATAGG + Intergenic
1072420842 10:95289982-95290004 CCTGGGGGTTTCACTTTATTAGG + Intronic
1073146132 10:101283040-101283062 CCAATTAGTTACTGTTTATTTGG - Intergenic
1073865153 10:107794379-107794401 CCTGATAGTTACTGTTTATTGGG + Intergenic
1076388568 10:130077437-130077459 CATGTGATTCTCAGTTTATTTGG - Intergenic
1081512347 11:43788748-43788770 CCTGTGTGTTACAATTACTTAGG - Intronic
1082929022 11:58579620-58579642 CCTGTGAGTAACAGTCTTTCAGG + Exonic
1083846165 11:65334700-65334722 CCTGTGAGTTAAAGATGCTTTGG + Intronic
1087121438 11:94578748-94578770 CCTGTTAGTATGAGTTTATTTGG + Intronic
1088346083 11:108827274-108827296 CATGGGAGTTACAGTCTATTAGG + Intronic
1089428699 11:118402423-118402445 CCTCTGAGTACTAGTTTATTTGG + Intronic
1090384727 11:126350795-126350817 TCTGTGAGTTCCACTTTGTTAGG + Intergenic
1091614306 12:2037434-2037456 GCTGTGAGTTAAAGTATCTTCGG + Intronic
1095153399 12:38822645-38822667 CCTGGGTGTTACAATTGATTAGG - Intronic
1096559935 12:52428868-52428890 CCTGAAGCTTACAGTTTATTGGG + Intronic
1097544109 12:60977301-60977323 CCTGTGAATTGCAGTATGTTTGG - Intergenic
1097561846 12:61216833-61216855 CCTGTGAAGTACAATGTATTTGG - Intergenic
1098695828 12:73553767-73553789 CCAGTGTATTACATTTTATTTGG + Intergenic
1099985842 12:89663001-89663023 CCCATGAGTTACAGTTCACTGGG - Intronic
1103022383 12:117545731-117545753 CCTGTGAGTTAAACATTTTTTGG + Intronic
1103622606 12:122197597-122197619 CCTGTGAGAAACAGTTTAAATGG - Intronic
1104267288 12:127245277-127245299 CCTGTGAGTTGAGGTTTGTTTGG + Intergenic
1105923238 13:24984195-24984217 CCTGAGATTTACTGTTTAATGGG - Intergenic
1111929985 13:94503046-94503068 CCTGTGAATGTCACTTTATTTGG + Intergenic
1113166184 13:107445872-107445894 CCTGTGATTTATTCTTTATTTGG + Intronic
1113508481 13:110832667-110832689 CCTGTGAATGAGAGCTTATTTGG + Intergenic
1113682247 13:112252721-112252743 ATTGTGAGTTACAGTTTAAAAGG + Intergenic
1114911694 14:27207247-27207269 CCTATGAGTTCCAGGTGATTTGG - Intergenic
1116642233 14:47478769-47478791 CCTGTGAGTTAGAGATTAAGTGG + Intronic
1118062929 14:62160551-62160573 CCTGGGGTTTATAGTTTATTGGG - Intergenic
1120029180 14:79620996-79621018 TCTGTGGGTTACACTTTTTTTGG - Intronic
1120127521 14:80763684-80763706 CCTGAAATTAACAGTTTATTTGG - Intronic
1121877111 14:97463582-97463604 CCTGTAAGGTACAGATCATTGGG + Intergenic
1125400663 15:39299159-39299181 CCTTGGATTTACATTTTATTTGG - Intergenic
1126209375 15:46082624-46082646 CCTGTGGCTTACAGATTTTTTGG + Intergenic
1128356888 15:66934356-66934378 CCTGTGAATGTGAGTTTATTTGG + Intergenic
1129038050 15:72662875-72662897 CCTGTGAGCTACAGCTCATCGGG + Intronic
1129211840 15:74074356-74074378 CCTGTGAGCTACAGCTCATCGGG - Intronic
1129398563 15:75266728-75266750 CCTGTGAGCTACAGCTCATCGGG + Intronic
1129402171 15:75291004-75291026 CCTGTGAGCTACAGCTCATCGGG + Intronic
1129728961 15:77918628-77918650 CCTGTGAGCTACAGCTCATCAGG - Intergenic
1130065446 15:80599675-80599697 ACTTTGAGTAACAGTTTCTTAGG + Intergenic
1132437550 15:101821592-101821614 CCTGTGGGTTACAGTTATTATGG + Intergenic
1134621172 16:15690681-15690703 CCTGTGGGTTTCCCTTTATTTGG + Intronic
1142408745 16:89905487-89905509 CCTGTCAGTTGCAGCATATTAGG - Intronic
1144201979 17:12949756-12949778 CCTGTGAGTTACAGTTTATTTGG + Intronic
1144289742 17:13814956-13814978 CCTGAGAGTGATAGTTTCTTAGG + Intergenic
1145922022 17:28616815-28616837 CCTGTGTGTTACACGATATTAGG - Intronic
1147539538 17:41345667-41345689 CTTTTGAATAACAGTTTATTAGG + Intergenic
1148120399 17:45206510-45206532 GCTGTGAGTCCCAGTCTATTTGG + Intergenic
1152477941 17:80530455-80530477 CCTGTGAATTTGACTTTATTTGG + Intergenic
1155575632 18:27243030-27243052 GCAGTGTGTCACAGTTTATTAGG - Intergenic
1155703216 18:28775577-28775599 TCTCTGAGTTTCAGTTCATTTGG - Intergenic
1155822254 18:30392223-30392245 CATCAAAGTTACAGTTTATTTGG + Intergenic
1155971127 18:32084728-32084750 CCTCTATGTTACAGTTGATTAGG - Intergenic
1156122067 18:33857111-33857133 CCTGATAGTTACCTTTTATTAGG + Intronic
1157430528 18:47620689-47620711 CCTGTGAATGTCACTTTATTTGG - Intergenic
1158352303 18:56575140-56575162 CCAGTGTGTTGCATTTTATTAGG - Intergenic
1158737115 18:60094999-60095021 TCTGTGAATTTCAGTTTATCAGG - Intergenic
1159740884 18:72168812-72168834 ACTGTGAGTTACGTTTTTTTTGG - Intergenic
1159836468 18:73342781-73342803 CCTGTGAGCTAAAGATTTTTGGG - Intergenic
1160281115 18:77492114-77492136 CCGGAAAGTTACAGTTTAATAGG + Intergenic
1161874359 19:6896229-6896251 CCTGTGAATTTCATCTTATTTGG - Intronic
1164447547 19:28330888-28330910 CCTTGAAGTTCCAGTTTATTAGG - Intergenic
1165817894 19:38654105-38654127 TCTATGAGTTACATTTTACTCGG + Intronic
1166451437 19:42905925-42905947 AGTGAGAGTTACTGTTTATTGGG + Intronic
1166463687 19:43014120-43014142 AGTGAGAGTTACTGTTTATTGGG + Intronic
1166469836 19:43070702-43070724 AGTGAGAGTTACTGTTTATTGGG + Intronic
1166480970 19:43174217-43174239 GGAGTGAGTTACTGTTTATTGGG + Intronic
1166490548 19:43257204-43257226 AGTGAGAGTTACTGTTTATTGGG + Intronic
925865924 2:8225662-8225684 CCAGTGTGTTACAGGTTGTTTGG + Intergenic
925890442 2:8429949-8429971 CATGTGAATTACAGGTTATTTGG + Intergenic
927219130 2:20690589-20690611 CCTGTGATTTATAATTTATAGGG - Intronic
927344720 2:22024628-22024650 CCTGGGAGATACAGTCTTTTAGG - Intergenic
928693307 2:33823111-33823133 CCTGTAAGTGGCAATTTATTTGG + Intergenic
929552171 2:42901443-42901465 CCTGTGAGTCACAGCTTTCTAGG - Intergenic
929866539 2:45722015-45722037 CCAGAGAGTTTCTGTTTATTTGG + Intronic
929889170 2:45905298-45905320 CCTCTGAGTTACTTTTTTTTTGG - Intronic
930389886 2:50747262-50747284 CCTGTTGGTTAGAGTTTACTTGG + Intronic
931652467 2:64480901-64480923 CCTTTGAGTTGCAGTTAATTGGG - Intergenic
933412434 2:81942820-81942842 ACTGTGTGTTACATTTGATTTGG - Intergenic
934479939 2:94627894-94627916 CTTCTGAGTTCCACTTTATTGGG + Intergenic
936778901 2:116007925-116007947 CCTGTGGCTGACAGTGTATTAGG + Intergenic
942521513 2:176809108-176809130 CCTGTGATTTACAGTTTATTAGG - Intergenic
942540557 2:177010893-177010915 CCTTTGAGTTACCTTTAATTGGG - Intergenic
946002013 2:216490269-216490291 CCTGTGAGTCACAGTCTTTTGGG + Intergenic
1169584377 20:7063772-7063794 CCTGGGACTTAAATTTTATTTGG - Intergenic
1173063868 20:39690551-39690573 CCTGTGAATGAGAATTTATTTGG - Intergenic
1179151937 21:38816420-38816442 CCTGTGAGTTTGTGTGTATTTGG + Intronic
1179992897 21:44957805-44957827 TCTGTGAGGTTCAGTTTAATGGG + Intronic
1181498193 22:23300159-23300181 CCTGGGAGTTATTGTTTAATGGG - Intronic
1182378962 22:29871009-29871031 CCTGAGACTTACAGTCTAGTTGG - Intergenic
949134272 3:543725-543747 CCTGTGAGTTACAAGAAATTGGG + Intergenic
950735741 3:15006675-15006697 CCTGGGAGGAACAGTTTCTTGGG - Intronic
952891921 3:38048817-38048839 CCTGAGTGTTACTGTTTAATGGG - Intronic
955020749 3:55118738-55118760 CATGTGTGCTACAGTTTCTTGGG - Intergenic
956308287 3:67850545-67850567 CCTGTGAGTAACTGTTGAATGGG - Intergenic
957186973 3:76954330-76954352 CATGTGAGTTATGGTTTATTAGG - Intronic
960912807 3:122666147-122666169 CCTCAGATTTACAGCTTATTTGG - Intergenic
962275900 3:134013245-134013267 ACTTTGATTTACAGTGTATTTGG - Intronic
963256416 3:143148965-143148987 CCCATTAGTTACCGTTTATTGGG - Intergenic
963292808 3:143510779-143510801 CCTGTGAGTCACATTTTCCTGGG + Intronic
963897470 3:150702646-150702668 CCTGTGAATTACAGGATATTTGG - Intronic
965485696 3:169275727-169275749 CATGTGAGTTACAGATTAAATGG + Intronic
967527307 3:190509614-190509636 CCTTTGATTTACATTTTTTTGGG - Intergenic
968925275 4:3543822-3543844 ACTGTGAGTTGCAGTTTAAAAGG + Intergenic
970518103 4:16854336-16854358 ACTGTGACTTCAAGTTTATTTGG - Intronic
971971915 4:33631895-33631917 CCTGTGAGTTTGAGATTATTTGG - Intergenic
973828097 4:54729826-54729848 CCAGTGAGATACTGTTTATAGGG + Intronic
974734330 4:65910121-65910143 CTTGTGAGACACAGTTTATATGG + Intergenic
975176472 4:71295230-71295252 CCTGTGAGTTAGAGTATCATGGG - Intronic
976961671 4:90983755-90983777 CCTGAGTGTTAAATTTTATTAGG - Intronic
979289073 4:118959887-118959909 CCTGTGAGTGTTATTTTATTTGG + Intronic
980542839 4:134216762-134216784 CCTTTTAGTTTAAGTTTATTAGG - Intergenic
981980217 4:150782714-150782736 CCTGTGAATGTTAGTTTATTTGG - Intronic
982969188 4:161959738-161959760 TCTGTGCTTTACAATTTATTGGG + Intronic
983566168 4:169154169-169154191 CCTGTGAGTTAAGGGTTGTTTGG + Intronic
984761906 4:183369684-183369706 CATGTGAGCAACAGTTTAGTAGG - Intergenic
985058349 4:186055456-186055478 GCAGGGAGTTACTGTTTATTGGG - Intergenic
986693431 5:10332555-10332577 CATGTGAGTTACATATAATTAGG + Intergenic
987250979 5:16101050-16101072 CCTGTGAGATACAGAATCTTTGG - Intronic
988120503 5:26955082-26955104 ACAGTGAGTAACAGCTTATTAGG - Intronic
988375846 5:30434705-30434727 ACTGGGAGTTACAGTTCATTGGG + Intergenic
988425463 5:31058546-31058568 CTTTTGAGTTACAGGTTATGGGG - Intergenic
990333055 5:54746142-54746164 CCTATGGCTTACAGTTTAGTGGG - Intergenic
992709530 5:79436381-79436403 ACTGTCAGTTACAGTACATTAGG - Intronic
996468262 5:123828612-123828634 CCTGTGTTTTCCAGTTTATCAGG - Intergenic
998692038 5:144597936-144597958 CCTGTGAATGTGAGTTTATTTGG + Intergenic
999935970 5:156486194-156486216 CCTGTGTGTCACAGTTTTCTGGG + Intronic
1001973597 5:175978342-175978364 CCAGGGAGTTACTGTTTAATGGG + Intronic
1002243836 5:177865437-177865459 CCAGGGAGTTACTGTTTAATGGG - Intergenic
1002648983 5:180677785-180677807 CTTGGGAGTTACTGTTTAGTGGG - Intergenic
1003400165 6:5784281-5784303 CCTGAGATTTACTGTTTAATGGG - Intergenic
1003602625 6:7531480-7531502 GCTGTGAGTTAGTGTTTAATGGG + Intergenic
1004065698 6:12241735-12241757 CCTATGAGTAACACTTTTTTTGG + Intergenic
1005701632 6:28406935-28406957 CCTCTGAGTTACAGGTCCTTAGG + Intergenic
1005895374 6:30172887-30172909 TCTGTGAGTCACACTTTCTTAGG - Intergenic
1006746697 6:36347695-36347717 CCTGGGAATTGCAGTTTGTTGGG - Intergenic
1008783742 6:55140328-55140350 CTTGTGAGTTTTAGTCTATTAGG + Intronic
1009196951 6:60698098-60698120 ACAGTGAGATACATTTTATTTGG - Intergenic
1011975100 6:93286069-93286091 TCTCTGAGTTACAGTCTGTTTGG + Intronic
1013341312 6:109218876-109218898 CCAGTGAGTTATAGATTAGTTGG + Intergenic
1013463112 6:110394444-110394466 CCTGGGGGTTATTGTTTATTGGG - Intronic
1013839939 6:114379395-114379417 CCTGAGAGTTAGAGTTTACCAGG - Intergenic
1014032793 6:116725517-116725539 CCTCTGATTTTCATTTTATTGGG + Intronic
1014820430 6:125983086-125983108 CCTGTGATTCAAATTTTATTTGG - Intergenic
1016049025 6:139510529-139510551 TCTGAGAGCTAAAGTTTATTTGG - Intergenic
1018244371 6:161807846-161807868 CCTGTGAGTGGCAGTTTATTTGG - Intronic
1018345512 6:162895019-162895041 CCTAAAAGTTATAGTTTATTTGG - Intronic
1018697620 6:166402702-166402724 CCTGTGAGTTAGAGGTCCTTTGG + Intergenic
1022862953 7:34386896-34386918 CCTGTAATTTACAATTTATAGGG + Intergenic
1023212863 7:37827043-37827065 CACGTGAGTGACATTTTATTTGG + Intronic
1023823970 7:43996394-43996416 TCAGAGAGTTACAGTTTAATGGG - Intergenic
1023987621 7:45106017-45106039 CCTGTGAGTCACTGTTTCTGTGG + Intronic
1026546627 7:71328724-71328746 CCTGTGAATTACATATTTTTTGG - Intronic
1026811306 7:73468344-73468366 CCTGTGCATTATAGGTTATTCGG - Intronic
1027328129 7:77064050-77064072 TCAGAGAGTTACAGTTTAATGGG + Intergenic
1027559636 7:79711989-79712011 GCTGTGAGAAAGAGTTTATTTGG - Intergenic
1027559735 7:79713706-79713728 CCTATGAGTTAACGTTTTTTAGG - Intergenic
1027623414 7:80520546-80520568 GCTGTAATTTACAGTTTAATAGG + Intronic
1029752238 7:102549800-102549822 TCAGAGAGTTACAGTTTAATGGG - Intronic
1029770190 7:102648894-102648916 TCAGAGAGTTACAGTTTAATGGG - Intronic
1030146081 7:106357493-106357515 CATGTGATGTACAGTTTATGTGG - Intergenic
1030269412 7:107654319-107654341 CCTGAGAGGTAGTGTTTATTAGG - Intergenic
1030876617 7:114820751-114820773 ACTGTGAGTTGGAGTTAATTGGG + Intergenic
1031037928 7:116808467-116808489 CCTGTAAGCTACAGTTGTTTTGG - Intergenic
1035693488 8:1575336-1575358 CCTGTGAGTTCCATTGTTTTAGG - Intronic
1036474094 8:9077452-9077474 CCTCTGAGTCACAGTTTGTGCGG - Intronic
1037046152 8:14306407-14306429 CCAGTGCTTTACATTTTATTTGG - Intronic
1039697641 8:39929572-39929594 CCTGAGAGATCCAGATTATTGGG + Intergenic
1041082709 8:54228436-54228458 TGTGTGTGTTACAGATTATTTGG + Intergenic
1042584970 8:70326044-70326066 ACACTGAGTTACAGTTTAATAGG + Intronic
1044599813 8:93992285-93992307 CCTATCAGTGACAGTGTATTGGG + Intergenic
1050531227 9:6591395-6591417 CCTGGTGCTTACAGTTTATTAGG - Intronic
1051618021 9:19024822-19024844 CAGGTGATTTATAGTTTATTTGG - Intronic
1052828051 9:33191515-33191537 CCTGTGAAAAACAATTTATTTGG + Intergenic
1053800164 9:41759004-41759026 ACTGTGAGTTGCAGTTTAAAAGG + Intergenic
1054145029 9:61555831-61555853 ACTGTGAGTTGCAGTTTAAAAGG - Intergenic
1054188592 9:61971156-61971178 ACTGTGAGTTGCAGTTTAAAAGG + Intergenic
1054464725 9:65486788-65486810 ACTGTGAGTTGCAGTTTAAAAGG - Intergenic
1054506721 9:65920392-65920414 CTTCTGAGTTCCACTTTATTGGG + Intergenic
1054649929 9:67617461-67617483 ACTGTGAGTTGCAGTTTAAAAGG - Intergenic
1055193397 9:73556112-73556134 CCTTTAACTAACAGTTTATTGGG - Intergenic
1055703848 9:78976318-78976340 CCGGTGAGTTATAGTCTGTTTGG + Intergenic
1055870123 9:80866758-80866780 CCTATGAATCACAGTTTACTAGG - Intergenic
1058024544 9:100126766-100126788 TCTGTGATCTAAAGTTTATTGGG + Intronic
1058324505 9:103678804-103678826 CCTCTGAATTTTAGTTTATTAGG + Intergenic
1060139486 9:121196395-121196417 ATTGTGAGTTACTATTTATTGGG + Intronic
1185653495 X:1666278-1666300 CCTGTCAGTGACACTTTATTTGG - Intergenic
1185865310 X:3619084-3619106 CCTGTGAATATCACTTTATTTGG + Intronic
1188537561 X:31214484-31214506 GCTGTGAGTTTCAGTTAGTTAGG - Intronic
1189739828 X:44106280-44106302 CCTGTGAGTGTGACTTTATTTGG + Intergenic
1192537984 X:71944869-71944891 ACTGTGAGTTTTAGTATATTAGG + Intergenic
1193978506 X:88153086-88153108 TCTTTAAGGTACAGTTTATTTGG - Intergenic
1194211502 X:91075232-91075254 TCTGTGAGTGAAAGTTTCTTTGG - Intergenic
1198240656 X:134782231-134782253 ACTGTGAGTTTCAGTTATTTGGG - Intronic
1199265742 X:145823554-145823576 CCTGTTAGGTAGAGTTTCTTTGG - Exonic
1200798383 Y:7362411-7362433 CCTGTGAATATCACTTTATTTGG - Intergenic
1200856785 Y:7947519-7947541 GCTGTATGTTACAGTTTACTTGG + Intergenic
1201574480 Y:15447591-15447613 CCTGTGTGTTAAAATTTCTTTGG - Intergenic