ID: 1144206709

View in Genome Browser
Species Human (GRCh38)
Location 17:12984642-12984664
Sequence TCCATAGGGTGACGGGGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144206709_1144206718 5 Left 1144206709 17:12984642-12984664 CCAGCACCCCGTCACCCTATGGA 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1144206718 17:12984670-12984692 CTACCCTCAGGGGTACTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1144206709_1144206716 -6 Left 1144206709 17:12984642-12984664 CCAGCACCCCGTCACCCTATGGA 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1144206716 17:12984659-12984681 TATGGACTGAGCTACCCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1144206709_1144206721 11 Left 1144206709 17:12984642-12984664 CCAGCACCCCGTCACCCTATGGA 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1144206721 17:12984676-12984698 TCAGGGGTACTCCTTGGCCTCGG 0: 1
1: 0
2: 0
3: 9
4: 126
1144206709_1144206715 -7 Left 1144206709 17:12984642-12984664 CCAGCACCCCGTCACCCTATGGA 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1144206715 17:12984658-12984680 CTATGGACTGAGCTACCCTCAGG 0: 1
1: 0
2: 1
3: 4
4: 101
1144206709_1144206717 -5 Left 1144206709 17:12984642-12984664 CCAGCACCCCGTCACCCTATGGA 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1144206717 17:12984660-12984682 ATGGACTGAGCTACCCTCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 112
1144206709_1144206722 12 Left 1144206709 17:12984642-12984664 CCAGCACCCCGTCACCCTATGGA 0: 1
1: 0
2: 0
3: 15
4: 86
Right 1144206722 17:12984677-12984699 CAGGGGTACTCCTTGGCCTCGGG 0: 1
1: 0
2: 1
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144206709 Original CRISPR TCCATAGGGTGACGGGGTGC TGG (reversed) Exonic
901451734 1:9340113-9340135 GCCCTAGGGTCACCGGGTGCAGG + Intronic
906245164 1:44268264-44268286 CCCATAGGGTGACTGGTGGCTGG + Intronic
906687717 1:47773101-47773123 CCCATGGGGTGACGGGAAGCTGG - Intronic
909212561 1:72843129-72843151 TCCATAGGGTTTTGGGGAGCAGG - Intergenic
911123942 1:94322932-94322954 GCCACAGGGTGAGAGGGTGCTGG - Intergenic
922148949 1:222979732-222979754 TGCATAGAGGGACGGAGTGCAGG - Intronic
1062837605 10:646265-646287 TGCACAGGGGGACAGGGTGCGGG - Intronic
1064964626 10:21002660-21002682 TCCATTGTGTGAGGGTGTGCTGG - Intronic
1067524141 10:47028199-47028221 CCCATAGGGTTACTGGGTGAGGG - Intergenic
1070620851 10:78009660-78009682 TCCACAGGGTGACAGGCTGAGGG + Exonic
1073939563 10:108680027-108680049 TCCAATGGGTGATGGGGTGGAGG - Intergenic
1074544209 10:114389848-114389870 TCCATAGGGTGAGGGGTGGTGGG + Intronic
1074971381 10:118542292-118542314 TCCCTGGGATGATGGGGTGCTGG - Intergenic
1076868219 10:133179807-133179829 GCCACAGGGCGACGGGGAGCCGG - Intronic
1081987431 11:47316307-47316329 TCTATAGGATGAAGGGGTGAGGG - Intronic
1083629932 11:64090199-64090221 TCCACAGGGTGACAGGGTGTGGG + Intronic
1086437908 11:86800223-86800245 TTCAAAGGGTGACGGCGCGCGGG + Exonic
1088240190 11:107766027-107766049 TCCATAGGTTAATGGGGTACGGG - Intergenic
1089406099 11:118198838-118198860 CCCATGGGGTGACGGGTTGCAGG - Intronic
1089566294 11:119373373-119373395 CCCATAGGAGGACGGGGTGTAGG + Exonic
1089639741 11:119839803-119839825 TCCGTGGGGAGAGGGGGTGCAGG + Intergenic
1093196542 12:16136202-16136224 TCCATATGGTGAGTGGGTGGAGG - Intergenic
1096514573 12:52148845-52148867 TCCATGGGGTGAGGGGGTGTGGG - Intergenic
1101417367 12:104520019-104520041 TCCATCAGGGAACGGGGTGCAGG + Intronic
1101735355 12:107459129-107459151 TCCATAGGGTTGTGGGGGGCAGG - Intronic
1102497565 12:113330088-113330110 TCCACAGGGTGAGGGGGAGGGGG - Intronic
1103444581 12:120986096-120986118 TCCAGAGGAGAACGGGGTGCTGG - Intronic
1103930662 12:124449191-124449213 GCCATTGGGTGAGGCGGTGCTGG - Intronic
1103941959 12:124506078-124506100 TGCCTGGGGTGAAGGGGTGCAGG - Intronic
1104949317 12:132431938-132431960 TGCACAGGGTCACTGGGTGCTGG - Intergenic
1107092439 13:36496441-36496463 TACATAGGGTCACAGGGAGCAGG - Intergenic
1108267390 13:48725908-48725930 TCCATAGGGTATTGGGGTACAGG - Intergenic
1113490998 13:110691824-110691846 ACCAGAGGGTTAGGGGGTGCAGG + Intronic
1116652301 14:47609074-47609096 TCCATAGGTTATTGGGGTGCAGG + Intronic
1121178160 14:91906528-91906550 TCCAAAGGGTGATGGGGAGCAGG - Intronic
1124105771 15:26736643-26736665 TCCATAGGGTGGGGTGCTGCAGG + Intronic
1124668370 15:31614276-31614298 TCCATAGGTTATTGGGGTGCAGG - Intronic
1128254488 15:66186671-66186693 TCCATGGGGTGAGTGGGTGGAGG - Intronic
1128786795 15:70403542-70403564 TCCATATGGTGACAGTGTGGGGG - Intergenic
1130181613 15:81635069-81635091 TCCATAGGTTGTTGGGGTACAGG + Intergenic
1130296135 15:82647974-82647996 TTCATAAGCTGCCGGGGTGCGGG - Intronic
1130972285 15:88742278-88742300 GCCATAGGGAGACTGGGTGCTGG - Intergenic
1132615676 16:840213-840235 TCCACAGGGAGCAGGGGTGCAGG - Intergenic
1138181860 16:54945957-54945979 TCCACTGGGTGACTGGGTGCAGG - Intergenic
1144206709 17:12984642-12984664 TCCATAGGGTGACGGGGTGCTGG - Exonic
1151878565 17:76881080-76881102 TCCATAGGGTGCTGGGCTCCAGG - Intronic
1152939904 17:83162924-83162946 TCCAGATGCTGATGGGGTGCTGG + Intergenic
1158372861 18:56829402-56829424 TCCACATGGGGAGGGGGTGCTGG - Intronic
1162651347 19:12091267-12091289 TGCATAGGGTCACTGGGTTCAGG + Intergenic
1164513520 19:28915788-28915810 TCCAGAGGGTGACAGGGGCCAGG - Intergenic
1165961087 19:39534746-39534768 TCCATAGAAGGACGGGGGGCAGG - Intergenic
1166369484 19:42293090-42293112 TCCAGAGGCTGCCGGGGTGCAGG - Exonic
1166861945 19:45816128-45816150 TCCTGAGGGGGCCGGGGTGCTGG + Exonic
1168113474 19:54208017-54208039 ACCAGAGGCTGACGGGTTGCTGG + Intronic
925212462 2:2061649-2061671 TCCATTGGGTGACAGGGAGCTGG - Intronic
925487188 2:4348459-4348481 TCCATAGGGAGACTGGATGGAGG - Intergenic
925994235 2:9278893-9278915 TCTATAGGGGGAAGGGGTGCAGG + Intronic
927965136 2:27263394-27263416 GCCACAGGGTGACGGCGTGGTGG - Intronic
929288546 2:40163683-40163705 TCCATAGGAGGAGGGGGTCCGGG - Intronic
930860675 2:56069938-56069960 TTCATGGTGTGACTGGGTGCAGG + Intergenic
935215377 2:100971524-100971546 CCCATAGGGTGCCTGGGTCCTGG - Intronic
935315314 2:101827662-101827684 TCCACAGGGTAACAGTGTGCAGG - Intronic
936510341 2:113140054-113140076 TCCATAGGTTAATGGGGTACAGG + Intergenic
938578056 2:132621899-132621921 TCCATAGGGTGCTGGGGTGTGGG + Intronic
945111129 2:206360786-206360808 ACCATAGGGAGACGGGGAGCAGG + Intergenic
946228449 2:218277290-218277312 TCCCTAGTGTGCCGGGGTCCGGG + Intronic
948234573 2:236378944-236378966 TCCATAGGGGGAGGGGCTGCAGG - Intronic
948768712 2:240236475-240236497 TCCCTAGGGAGATGGGGTGAGGG - Intergenic
1175881499 20:62262089-62262111 GGCAGAGGGTGACGGGGTGGGGG - Intronic
1179889564 21:44328726-44328748 TGCATTGGGTGAGGAGGTGCCGG + Intergenic
1182050629 22:27310268-27310290 GCCATGGGGTGACGGTGGGCAGG + Intergenic
1184170152 22:42754063-42754085 TCAAGAGGGTGACGTGCTGCTGG - Intergenic
950849726 3:16051199-16051221 GCCAGAGGGTGAGGTGGTGCTGG - Intergenic
965793324 3:172411788-172411810 CCCCTAGGGTGGCGGGCTGCGGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
970476748 4:16431422-16431444 TCCATGGGGTGACAGAGTGGAGG - Intergenic
970493482 4:16600739-16600761 TTGATAGGGTGACGGTGTGGTGG + Intronic
971835701 4:31760242-31760264 GCCAGAGGGTGAAGGGGAGCTGG - Intergenic
975665031 4:76726972-76726994 TCCTTAGTGTCACGTGGTGCTGG + Intronic
982199382 4:152945317-152945339 TGCATAGGGTGCAGGGGTGGAGG - Intronic
985832079 5:2241132-2241154 TGGATGGGGTGACGAGGTGCGGG - Intergenic
990673168 5:58155316-58155338 TCCATAGGTTATTGGGGTGCAGG - Intergenic
997526122 5:134554360-134554382 TGCCTAGGGTGAAGGGGTGAAGG + Intronic
1003116499 6:3287076-3287098 TCCACAGGCTGACGGGGTACGGG - Exonic
1011186011 6:84676667-84676689 TCCAGAGGTTGATGGGGTGATGG + Intergenic
1013660278 6:112288906-112288928 TCCTTAGGGTGGAGGGGTGAGGG - Intergenic
1018173574 6:161160926-161160948 TCTATAGGGTGCTGGGGTGCTGG - Intronic
1018335614 6:162785565-162785587 GCCAGGGGGTGAAGGGGTGCGGG + Intronic
1030138874 7:106285143-106285165 CCCGGAGGGTGACGGGGTGAAGG - Exonic
1032691814 7:134294943-134294965 GCCACAGGGTGAAGGGGTTCTGG + Exonic
1049287912 8:141786588-141786610 TCAATAGGGTGACAGGATGCAGG - Intergenic
1056764011 9:89433707-89433729 TCCAGAGGGTCACAGGGTCCGGG + Intronic
1058547113 9:106072466-106072488 TCCATGGGGGGGCGGGGTGGGGG - Intergenic
1059320329 9:113463814-113463836 TCCCGAGGGAGACGCGGTGCAGG - Intronic
1062473987 9:136718688-136718710 GTCATAGGGTGATTGGGTGCAGG + Intronic
1062572406 9:137191742-137191764 GCCATGGGGTGTCGGGGTGAAGG - Exonic
1186635551 X:11400499-11400521 GCCAGGGGGGGACGGGGTGCGGG - Intronic
1189454580 X:41174346-41174368 TCCATGGGGGGTGGGGGTGCAGG - Intronic
1189907996 X:45781666-45781688 TGCATAGGGTTATGGGGTGGGGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1199640111 X:149851760-149851782 TCCATAGGTTATTGGGGTGCAGG - Intergenic
1199926842 X:152476056-152476078 TCCATAGGTTGTTGGGGTACAGG - Intergenic