ID: 1144209276

View in Genome Browser
Species Human (GRCh38)
Location 17:13000993-13001015
Sequence CCCTTTGTTGGCATCTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144209276_1144209281 13 Left 1144209276 17:13000993-13001015 CCTGCGCAGATGCCAACAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1144209281 17:13001029-13001051 CAACCCCGTGATGTTGCCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144209276_1144209282 14 Left 1144209276 17:13000993-13001015 CCTGCGCAGATGCCAACAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1144209282 17:13001030-13001052 AACCCCGTGATGTTGCCTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144209276 Original CRISPR CCCTTTGTTGGCATCTGCGC AGG (reversed) Intronic
900247219 1:1642346-1642368 CACTGTGCTGGCTTCTGCGCAGG + Exonic
900258443 1:1709478-1709500 CACTGTGCTGGCTTCTGCGCAGG + Intronic
903319922 1:22536785-22536807 CCATTTGTTGACTTCTGCTCTGG + Intergenic
905318150 1:37096646-37096668 CCCTTTGTTGACCTTTGGGCGGG + Intergenic
905971375 1:42144912-42144934 CCCTTTGCTGACATCTGCCTGGG - Intergenic
915110907 1:153564214-153564236 CATTTTGATGGCATCTGCGCAGG + Intronic
918341185 1:183569075-183569097 CCCTTTCTTGCCATCAGCTCAGG + Intronic
922579647 1:226687465-226687487 TCCTATGTTGGCCTCTGAGCTGG - Intronic
923515596 1:234695544-234695566 CCCTTGGATGGCATCTGATCAGG + Intergenic
923670482 1:236036551-236036573 CAATTTGTTGGCATCTGCTATGG + Intronic
924600113 1:245481296-245481318 CCATTTGTTGCCAGCTGGGCTGG - Intronic
1063266198 10:4453855-4453877 CCCTTTCTTGGCATCTGGATGGG - Intergenic
1069191429 10:65495659-65495681 CCCTTTCTTGGCATCTGGATCGG + Intergenic
1074623279 10:115149201-115149223 CCTTTTGTTGCCATGTGTGCAGG - Intronic
1076387582 10:130068195-130068217 ACCTTTCCTGGCATCTGCACAGG - Intergenic
1080268407 11:30424960-30424982 CCCTTTGGAGGCAGCTGGGCTGG - Intronic
1083978235 11:66142003-66142025 ACCATTGTTGGCCTCTGGGCTGG + Intronic
1087181701 11:95148552-95148574 CCCTTCTTTTGCATCTGGGCTGG - Intergenic
1090152601 11:124401676-124401698 CCTTTTGGTGGCATCTAAGCTGG - Intergenic
1091291383 11:134442213-134442235 CCCTTTGGTGGTGTCTGAGCTGG - Intergenic
1104554103 12:129784537-129784559 CCCATTTTCGGCATCTGTGCTGG + Intronic
1105365635 13:19761851-19761873 TTCTTTGTTGGCCTCTGCTCAGG - Intronic
1105424931 13:20285767-20285789 CCCATGGTTGGCACCTGCACAGG + Intergenic
1105572464 13:21616200-21616222 CCTTTTTTTGGCATGTGCGAGGG + Intergenic
1106514517 13:30441664-30441686 CACTTTGTTGGCAAATGTGCAGG + Intergenic
1107282835 13:38756059-38756081 CCCTTTTCTGGCATATGCTCAGG - Intronic
1108738881 13:53314218-53314240 CCCTTTCTTGGCAGCTGTGAGGG + Intergenic
1113381280 13:109808306-109808328 CCCTCAGTTGGCATCCGCGACGG + Intergenic
1114707371 14:24741009-24741031 CCCTTTGCAGGCATCTGAGGTGG - Intergenic
1119181005 14:72605262-72605284 CTCTCTGCTGGCATCTGGGCTGG - Intergenic
1121085975 14:91146412-91146434 CTCTTTGTTGGAATAAGCGCAGG + Intronic
1122424814 14:101599697-101599719 CCCACTGTGGGCATCTGTGCAGG - Intergenic
1202853881 14_GL000225v1_random:37842-37864 CCACTTGTTGGCACCTGGGCCGG - Intergenic
1125456283 15:39862381-39862403 GCATTTGTTGGCATGTGAGCTGG + Intronic
1127204513 15:56700014-56700036 CACTGTGTTGGCATTTGCACTGG - Intronic
1130423131 15:83768349-83768371 CCATTTGTTGGAATCTGCTCTGG - Intronic
1131432983 15:92401348-92401370 CTCTTGGGTGGCATCTGGGCTGG + Intronic
1132618345 16:853091-853113 CCCTCTGTTGGCACCTGGGCTGG + Intergenic
1136471512 16:30483856-30483878 CACTTTGGTGGCATCTGGCCGGG - Exonic
1140127493 16:72130452-72130474 CCCTCTGTGGGCAGCTGCCCAGG - Intronic
1142475481 17:186429-186451 TCCTTGGTTGGCATCTTGGCTGG + Intergenic
1143680249 17:8470884-8470906 GCCTTTCTTGGCAGCTGCCCCGG + Intronic
1144209276 17:13000993-13001015 CCCTTTGTTGGCATCTGCGCAGG - Intronic
1146489043 17:33266780-33266802 GCCTTTCTTGACATCTGCGAGGG - Intronic
1147458432 17:40553249-40553271 CCCTTTGCTGGCATGAGAGCTGG - Intergenic
1147582862 17:41636804-41636826 CCCAATGTTGGCATCAGAGCCGG + Intergenic
1149589582 17:57818593-57818615 CCCTTGGCTGGCATCTCTGCTGG - Intergenic
1152160616 17:78666378-78666400 ACCTTTGTTGGCATGTCTGCCGG + Intergenic
1153336476 18:3930944-3930966 TCCTATGTTGGCATCTGGGCTGG + Intronic
1153651151 18:7241370-7241392 CCCTTTGGTGGCTTCTTGGCTGG + Intergenic
1155702332 18:28762315-28762337 CCCTTTGCTGGCAGCTTCCCTGG - Intergenic
1156483680 18:37451602-37451624 CCCTCTGCTGGCATCCGAGCTGG + Intronic
1157577079 18:48750589-48750611 CCCTTGGTTTCCATCTGTGCTGG - Intronic
1160144535 18:76352742-76352764 CCCTTTGTTGTCATTTGTCCTGG - Intergenic
1161441548 19:4294585-4294607 CCCTTTGCTGGCAGCTGCGGCGG + Exonic
1164037286 19:21466259-21466281 ACCTGTGCTGGCATCTGCGCTGG - Intronic
1166389616 19:42401786-42401808 CCTGTTGTTCCCATCTGCGCCGG - Exonic
1167518668 19:49938920-49938942 CCCCCTGTTGGCATCAGTGCTGG + Intronic
1168291832 19:55360926-55360948 GACTTTGGTGGCATCTGGGCTGG + Intronic
926072624 2:9911321-9911343 CTCTTTGTTGGCATCTGGGAGGG - Intronic
934781065 2:96970064-96970086 CTCTTTGGTGGCATGTGAGCAGG - Intronic
941668059 2:168261415-168261437 CCCTATGAGGCCATCTGCGCAGG - Intergenic
944928470 2:204490910-204490932 CCCTTTGCAGGCTTCTGCCCAGG + Intergenic
946478389 2:220030766-220030788 CCCATTGATGGAATCTGGGCTGG + Intergenic
947947805 2:234121356-234121378 CCCTGGGATGGCATCTGCTCTGG + Intergenic
1172939359 20:38644021-38644043 ACCTTTGTTGGCCTCTGCACAGG + Intronic
1173906917 20:46636216-46636238 CCCTTTCTTGGGGTCTGCACTGG + Intronic
1175920369 20:62447867-62447889 CCCTCTGGTGTCATCTGCCCAGG - Intergenic
1184922522 22:47615399-47615421 CCCTTTCCTGCCATCTCCGCGGG - Intergenic
951038989 3:17967396-17967418 CCCTTCCCTGGCATCTGCCCTGG + Intronic
952848592 3:37709598-37709620 CCCTTGGTTGGCAGATGGGCGGG + Intronic
954578818 3:51691973-51691995 CCCTTTGTTGGCCTAGGCACTGG + Intronic
954809082 3:53236817-53236839 CCCTTCCTTGGCATCTCCTCGGG - Intronic
958048775 3:88318811-88318833 CCCATTGATGGCATCTGCCAGGG - Intergenic
973796583 4:54433443-54433465 CCCTTTGAGGCCATCTGCTCTGG - Intergenic
980972519 4:139580434-139580456 CCCTTTGGTGGCATCTTGCCTGG + Intronic
991390965 5:66143486-66143508 CACTTTGTTGCCATTTGCACTGG - Intronic
994994200 5:107038844-107038866 CTCTTTTTTGGCATCTCAGCTGG + Intergenic
995780009 5:115764592-115764614 CTTTTTGTTGGCATCTGCTAGGG - Intergenic
997570825 5:134925959-134925981 TGCTGTGTTGGCATCTGCTCGGG + Intronic
1004005351 6:11632899-11632921 CACTTTGTTGGCTTCTCTGCTGG + Intergenic
1004917973 6:20349746-20349768 CCCCTTGTAGGCATCAGGGCTGG + Intergenic
1005343268 6:24863421-24863443 GCCTTTGTTGGCATATTTGCAGG - Intronic
1005886331 6:30100758-30100780 CCCTTTGTTGTCCCCTCCGCAGG + Intergenic
1011559034 6:88596686-88596708 CCTGTTGTTAGCATCTGTGCTGG - Intergenic
1017763014 6:157585627-157585649 CCCCTTGTTCCCATCTGCCCTGG + Intronic
1028752174 7:94394183-94394205 CCTTTTGTTGGCAGGTGGGCTGG - Intergenic
1033728395 7:144146983-144147005 CCCACTGTTGGCATCTAGGCTGG - Intergenic
1044280637 8:90351527-90351549 CTCTTTCTTGGCAGCTGAGCTGG + Intergenic
1047212473 8:122850967-122850989 ACCTGTTTTGGCATTTGCGCTGG + Intronic
1047492798 8:125388376-125388398 CTCTTTGTTGGCTTCTTCGGGGG - Intergenic
1049306337 8:141906273-141906295 CCCAGTGTTGGCATCTGCCGTGG - Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1055618003 9:78093372-78093394 CCCTTTATTTGCATCTGGGCAGG + Intergenic
1056468492 9:86882378-86882400 GCCTTTGGAGGCATCTGTGCTGG - Intergenic
1062424683 9:136500615-136500637 CTGGATGTTGGCATCTGCGCTGG + Exonic
1202630515 M:12815-12837 TGCTGTGTTGGCATCTGCTCGGG - Intergenic
1187437225 X:19283705-19283727 CCCCTTGTTGACATCTGTTCAGG + Intergenic
1190301504 X:49059882-49059904 CCCTTTCTCGCCATCTGGGCGGG + Intronic