ID: 1144210818

View in Genome Browser
Species Human (GRCh38)
Location 17:13013852-13013874
Sequence TCAACGACGAGAAGCACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144210811_1144210818 0 Left 1144210811 17:13013829-13013851 CCCCGCCCCCAACTCAAAGCAAC 0: 1
1: 1
2: 1
3: 22
4: 245
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210812_1144210818 -1 Left 1144210812 17:13013830-13013852 CCCGCCCCCAACTCAAAGCAACT 0: 1
1: 2
2: 1
3: 22
4: 339
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210806_1144210818 29 Left 1144210806 17:13013800-13013822 CCACAAAACCTCTAGGGAACCCT 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210808_1144210818 10 Left 1144210808 17:13013819-13013841 CCCTTGTCACCCCCGCCCCCAAC 0: 1
1: 0
2: 3
3: 41
4: 475
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210810_1144210818 1 Left 1144210810 17:13013828-13013850 CCCCCGCCCCCAACTCAAAGCAA 0: 1
1: 0
2: 1
3: 43
4: 413
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210815_1144210818 -6 Left 1144210815 17:13013835-13013857 CCCCAACTCAAAGCAACTCAACG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210816_1144210818 -7 Left 1144210816 17:13013836-13013858 CCCAACTCAAAGCAACTCAACGA 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210813_1144210818 -2 Left 1144210813 17:13013831-13013853 CCGCCCCCAACTCAAAGCAACTC 0: 1
1: 1
2: 7
3: 48
4: 380
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210814_1144210818 -5 Left 1144210814 17:13013834-13013856 CCCCCAACTCAAAGCAACTCAAC 0: 1
1: 0
2: 2
3: 23
4: 243
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210807_1144210818 21 Left 1144210807 17:13013808-13013830 CCTCTAGGGAACCCTTGTCACCC 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210809_1144210818 9 Left 1144210809 17:13013820-13013842 CCTTGTCACCCCCGCCCCCAACT 0: 1
1: 0
2: 1
3: 55
4: 511
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1144210817_1144210818 -8 Left 1144210817 17:13013837-13013859 CCAACTCAAAGCAACTCAACGAC 0: 1
1: 0
2: 3
3: 45
4: 143
Right 1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144210818 Original CRISPR TCAACGACGAGAAGCACCTC TGG Intronic
912589360 1:110799425-110799447 TCAACTAGGAGAACAACCTCAGG - Intergenic
914390266 1:147214898-147214920 TAAATGAAGAGAAGCACCACTGG + Intronic
1063381264 10:5587695-5587717 TCCAGGACCAGGAGCACCTCCGG + Intergenic
1069885087 10:71618569-71618591 TAATCGAAGAGAAGCACCTCAGG - Intronic
1086969860 11:93068815-93068837 TCAAGAATGAGAAGCAGCTCTGG - Intergenic
1096189907 12:49609723-49609745 TCAACAACTAGCAACACCTCTGG + Intronic
1102295578 12:111733954-111733976 TCAAGGACAGCAAGCACCTCTGG - Exonic
1107889360 13:44900752-44900774 TCAACGAAGAGAAGAAGCTTGGG - Intergenic
1120399222 14:84006937-84006959 TGAACAAAGAGAAGCACCTGGGG - Intergenic
1120852520 14:89184377-89184399 TCAAGGAAGAAAAGCACCCCTGG + Intronic
1122688352 14:103520538-103520560 TCAACGAGGAGGACCACCTGCGG - Exonic
1129582777 15:76830650-76830672 TCAAGGAAGAGAAACACATCAGG + Intronic
1134879411 16:17731763-17731785 GCAACGAGGAGTAGAACCTCTGG - Intergenic
1139582457 16:67881471-67881493 CCATAGGCGAGAAGCACCTCAGG - Intronic
1140542657 16:75772327-75772349 TCAACTACTAGAAGGACCACAGG - Intergenic
1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG + Intronic
1166775300 19:45308478-45308500 TGAACGAGGAGGATCACCTCCGG - Exonic
926217384 2:10913865-10913887 TGACCGAGGAGAAGCACCACAGG + Exonic
927836667 2:26404492-26404514 TCAACTACCAGAAGCTCCACAGG - Intronic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
936542222 2:113361728-113361750 CCAATGAGGAGAAGCACCTGGGG - Intergenic
1169169428 20:3452739-3452761 TCAAGGATGAGAAGAACCTAGGG - Intergenic
1174732878 20:52935376-52935398 TCATCGACTTGAATCACCTCTGG - Intergenic
1174953436 20:55067702-55067724 TGACCGACCAGAAGCAGCTCTGG - Intergenic
951613722 3:24520362-24520384 TCAAAGACAAGAAGGAACTCTGG - Intergenic
954766885 3:52926027-52926049 TCACCGGAGGGAAGCACCTCTGG + Exonic
969487603 4:7480994-7481016 TCTAGGAGGAGAAGCCCCTCAGG - Intronic
971449140 4:26783942-26783964 GCAACCACCAGAGGCACCTCTGG - Intergenic
992311837 5:75509867-75509889 TCAGTAACGAGAAGCTCCTCAGG - Intronic
998099933 5:139424328-139424350 TCAAGGACAAGAAGCACAGCTGG - Intronic
1006154521 6:32007068-32007090 ACAACGAGGAGAAGCAGCTGAGG + Intergenic
1011132170 6:84063066-84063088 TCATCCACGGGAAGCACCTCCGG - Intronic
1016689271 6:146917252-146917274 TCAGGGAAGAGAAGCACATCAGG + Intergenic
1017549404 6:155489106-155489128 TGAACGGTGAGAAGCAGCTCTGG - Intergenic
1019048400 6:169165304-169165326 TCAACCAAGAGAAGCAGCTTTGG - Intergenic
1019342514 7:515277-515299 TAACAGACCAGAAGCACCTCTGG + Intronic
1020120631 7:5501240-5501262 TCAACGGCGGGAAGGACCTGCGG - Exonic
1020220401 7:6232280-6232302 GCAACTACAAGAAGCACCCCGGG + Intronic
1024090690 7:45937567-45937589 TGAACCACGACAAGCCCCTCTGG + Intergenic
1031441773 7:121803414-121803436 TCAACGACTAGGAGCAGCTGTGG + Intergenic
1031987179 7:128170755-128170777 TAAAAGACCAGAAGCTCCTCTGG - Intergenic
1037997400 8:23363234-23363256 TCAAGGTCGATAAGCACCCCGGG + Intronic
1041472768 8:58229673-58229695 TCAACTATGAGATGCACCTGGGG + Intergenic
1048992125 8:139766606-139766628 TCAATGAGGAGGAGCACCTGGGG - Intronic
1049391512 8:142373913-142373935 TCAACAAGAAGAAACACCTCAGG + Intronic
1055673625 9:78632493-78632515 TGAAAGACGAAAAGCACATCAGG - Intergenic
1057044209 9:91872322-91872344 AAAACGACGAGATGCACCCCAGG - Intronic
1059451352 9:114373040-114373062 TCAATGTCGAGAGGCACTTCCGG - Intronic
1060480043 9:124012389-124012411 TCATCGACGAGATGGACCGCAGG + Exonic
1195682699 X:107560774-107560796 TCATCAAAGAGAAGAACCTCCGG + Exonic
1196896193 X:120338967-120338989 TCAAAGACGAGGAGAACATCTGG - Intergenic
1197586921 X:128359752-128359774 TCAATGACAAGAAGCACCTAGGG - Intergenic