ID: 1144211994

View in Genome Browser
Species Human (GRCh38)
Location 17:13023556-13023578
Sequence AAGCCAAGGAGAGAGGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2242
Summary {0: 148, 1: 422, 2: 503, 3: 494, 4: 675}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144211994_1144211998 -1 Left 1144211994 17:13023556-13023578 CCTGAGGCCTCTCTCCTTGGCTT 0: 148
1: 422
2: 503
3: 494
4: 675
Right 1144211998 17:13023578-13023600 TGCAAATGGCCTTCCTCTTGCGG No data
1144211994_1144212001 12 Left 1144211994 17:13023556-13023578 CCTGAGGCCTCTCTCCTTGGCTT 0: 148
1: 422
2: 503
3: 494
4: 675
Right 1144212001 17:13023591-13023613 CCTCTTGCGGTACCTTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144211994 Original CRISPR AAGCCAAGGAGAGAGGCCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr