ID: 1144211995

View in Genome Browser
Species Human (GRCh38)
Location 17:13023563-13023585
Sequence CATTTGCAAGCCAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4594
Summary {0: 12, 1: 218, 2: 733, 3: 1196, 4: 2435}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144211995_1144211998 -8 Left 1144211995 17:13023563-13023585 CCTCTCTCCTTGGCTTGCAAATG 0: 12
1: 218
2: 733
3: 1196
4: 2435
Right 1144211998 17:13023578-13023600 TGCAAATGGCCTTCCTCTTGCGG No data
1144211995_1144212001 5 Left 1144211995 17:13023563-13023585 CCTCTCTCCTTGGCTTGCAAATG 0: 12
1: 218
2: 733
3: 1196
4: 2435
Right 1144212001 17:13023591-13023613 CCTCTTGCGGTACCTTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144211995 Original CRISPR CATTTGCAAGCCAAGGAGAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr