ID: 1144211998

View in Genome Browser
Species Human (GRCh38)
Location 17:13023578-13023600
Sequence TGCAAATGGCCTTCCTCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144211994_1144211998 -1 Left 1144211994 17:13023556-13023578 CCTGAGGCCTCTCTCCTTGGCTT 0: 148
1: 422
2: 503
3: 494
4: 675
Right 1144211998 17:13023578-13023600 TGCAAATGGCCTTCCTCTTGCGG No data
1144211995_1144211998 -8 Left 1144211995 17:13023563-13023585 CCTCTCTCCTTGGCTTGCAAATG 0: 12
1: 218
2: 733
3: 1196
4: 2435
Right 1144211998 17:13023578-13023600 TGCAAATGGCCTTCCTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144211998 Original CRISPR TGCAAATGGCCTTCCTCTTG CGG Intergenic
No off target data available for this crispr