ID: 1144212225

View in Genome Browser
Species Human (GRCh38)
Location 17:13025429-13025451
Sequence CTGTCCAGGGAGAAGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144212219_1144212225 -8 Left 1144212219 17:13025414-13025436 CCGGGGTGTCAGGAGCTGTCCAG No data
Right 1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG No data
1144212213_1144212225 13 Left 1144212213 17:13025393-13025415 CCGTGTGGAGACAGTAATAACCC No data
Right 1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG No data
1144212212_1144212225 14 Left 1144212212 17:13025392-13025414 CCCGTGTGGAGACAGTAATAACC No data
Right 1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG No data
1144212218_1144212225 -7 Left 1144212218 17:13025413-13025435 CCCGGGGTGTCAGGAGCTGTCCA No data
Right 1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144212225 Original CRISPR CTGTCCAGGGAGAAGGGTGA GGG Intergenic
No off target data available for this crispr