ID: 1144213283

View in Genome Browser
Species Human (GRCh38)
Location 17:13033039-13033061
Sequence CACCAGGAGTCCGCACTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144213283_1144213286 3 Left 1144213283 17:13033039-13033061 CCACACAGTGCGGACTCCTGGTG No data
Right 1144213286 17:13033065-13033087 AGTAACAGCACTTAGAGAACAGG No data
1144213283_1144213287 29 Left 1144213283 17:13033039-13033061 CCACACAGTGCGGACTCCTGGTG No data
Right 1144213287 17:13033091-13033113 CACGCATTCTGCCCTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144213283 Original CRISPR CACCAGGAGTCCGCACTGTG TGG (reversed) Intergenic
No off target data available for this crispr