ID: 1144213285

View in Genome Browser
Species Human (GRCh38)
Location 17:13033055-13033077
Sequence AAGTGCTGTTACTCGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144213285_1144213287 13 Left 1144213285 17:13033055-13033077 CCTGGTGGCGAGTAACAGCACTT No data
Right 1144213287 17:13033091-13033113 CACGCATTCTGCCCTGATGCTGG No data
1144213285_1144213290 26 Left 1144213285 17:13033055-13033077 CCTGGTGGCGAGTAACAGCACTT No data
Right 1144213290 17:13033104-13033126 CTGATGCTGGAACTCATAGTTGG No data
1144213285_1144213291 27 Left 1144213285 17:13033055-13033077 CCTGGTGGCGAGTAACAGCACTT No data
Right 1144213291 17:13033105-13033127 TGATGCTGGAACTCATAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144213285 Original CRISPR AAGTGCTGTTACTCGCCACC AGG (reversed) Intergenic
No off target data available for this crispr