ID: 1144213566

View in Genome Browser
Species Human (GRCh38)
Location 17:13035123-13035145
Sequence CAGCATTAGATGAAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144213558_1144213566 26 Left 1144213558 17:13035074-13035096 CCACTGCAGGACATTACAGGTTC No data
Right 1144213566 17:13035123-13035145 CAGCATTAGATGAAAGAGAGAGG No data
1144213562_1144213566 -1 Left 1144213562 17:13035101-13035123 CCCTGTACTTTTCTGGGAGTCCC No data
Right 1144213566 17:13035123-13035145 CAGCATTAGATGAAAGAGAGAGG No data
1144213561_1144213566 2 Left 1144213561 17:13035098-13035120 CCTCCCTGTACTTTTCTGGGAGT No data
Right 1144213566 17:13035123-13035145 CAGCATTAGATGAAAGAGAGAGG No data
1144213563_1144213566 -2 Left 1144213563 17:13035102-13035124 CCTGTACTTTTCTGGGAGTCCCA No data
Right 1144213566 17:13035123-13035145 CAGCATTAGATGAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144213566 Original CRISPR CAGCATTAGATGAAAGAGAG AGG Intergenic
No off target data available for this crispr