ID: 1144214457

View in Genome Browser
Species Human (GRCh38)
Location 17:13043105-13043127
Sequence CTTTTGCCTTCCATCATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144214457_1144214466 26 Left 1144214457 17:13043105-13043127 CCCATCATGATGGAAGGCAAAAG No data
Right 1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG No data
1144214457_1144214463 7 Left 1144214457 17:13043105-13043127 CCCATCATGATGGAAGGCAAAAG No data
Right 1144214463 17:13043135-13043157 ACATGTCACATGGTGAGAGATGG No data
1144214457_1144214461 -3 Left 1144214457 17:13043105-13043127 CCCATCATGATGGAAGGCAAAAG No data
Right 1144214461 17:13043125-13043147 AAGGGAGCCAACATGTCACATGG No data
1144214457_1144214464 22 Left 1144214457 17:13043105-13043127 CCCATCATGATGGAAGGCAAAAG No data
Right 1144214464 17:13043150-13043172 AGAGATGGAGCAAGAGAAAGAGG No data
1144214457_1144214465 25 Left 1144214457 17:13043105-13043127 CCCATCATGATGGAAGGCAAAAG No data
Right 1144214465 17:13043153-13043175 GATGGAGCAAGAGAAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144214457 Original CRISPR CTTTTGCCTTCCATCATGAT GGG (reversed) Intergenic
No off target data available for this crispr