ID: 1144214458

View in Genome Browser
Species Human (GRCh38)
Location 17:13043106-13043128
Sequence CCTTTTGCCTTCCATCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144214458_1144214464 21 Left 1144214458 17:13043106-13043128 CCATCATGATGGAAGGCAAAAGG No data
Right 1144214464 17:13043150-13043172 AGAGATGGAGCAAGAGAAAGAGG No data
1144214458_1144214467 30 Left 1144214458 17:13043106-13043128 CCATCATGATGGAAGGCAAAAGG No data
Right 1144214467 17:13043159-13043181 GCAAGAGAAAGAGGAGGGAGAGG No data
1144214458_1144214461 -4 Left 1144214458 17:13043106-13043128 CCATCATGATGGAAGGCAAAAGG No data
Right 1144214461 17:13043125-13043147 AAGGGAGCCAACATGTCACATGG No data
1144214458_1144214466 25 Left 1144214458 17:13043106-13043128 CCATCATGATGGAAGGCAAAAGG No data
Right 1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG No data
1144214458_1144214465 24 Left 1144214458 17:13043106-13043128 CCATCATGATGGAAGGCAAAAGG No data
Right 1144214465 17:13043153-13043175 GATGGAGCAAGAGAAAGAGGAGG No data
1144214458_1144214463 6 Left 1144214458 17:13043106-13043128 CCATCATGATGGAAGGCAAAAGG No data
Right 1144214463 17:13043135-13043157 ACATGTCACATGGTGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144214458 Original CRISPR CCTTTTGCCTTCCATCATGA TGG (reversed) Intergenic
No off target data available for this crispr