ID: 1144214462

View in Genome Browser
Species Human (GRCh38)
Location 17:13043132-13043154
Sequence TCTCTCACCATGTGACATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144214462_1144214466 -1 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG No data
1144214462_1144214464 -5 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214464 17:13043150-13043172 AGAGATGGAGCAAGAGAAAGAGG No data
1144214462_1144214467 4 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214467 17:13043159-13043181 GCAAGAGAAAGAGGAGGGAGAGG No data
1144214462_1144214465 -2 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214465 17:13043153-13043175 GATGGAGCAAGAGAAAGAGGAGG No data
1144214462_1144214469 13 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214469 17:13043168-13043190 AGAGGAGGGAGAGGGAGAAAAGG 0: 2
1: 4
2: 173
3: 866
4: 5257
1144214462_1144214468 5 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214468 17:13043160-13043182 CAAGAGAAAGAGGAGGGAGAGGG No data
1144214462_1144214471 15 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214471 17:13043170-13043192 AGGAGGGAGAGGGAGAAAAGGGG No data
1144214462_1144214470 14 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214470 17:13043169-13043191 GAGGAGGGAGAGGGAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144214462 Original CRISPR TCTCTCACCATGTGACATGT TGG (reversed) Intergenic
No off target data available for this crispr