ID: 1144214466

View in Genome Browser
Species Human (GRCh38)
Location 17:13043154-13043176
Sequence ATGGAGCAAGAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144214457_1144214466 26 Left 1144214457 17:13043105-13043127 CCCATCATGATGGAAGGCAAAAG No data
Right 1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG No data
1144214462_1144214466 -1 Left 1144214462 17:13043132-13043154 CCAACATGTCACATGGTGAGAGA No data
Right 1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG No data
1144214458_1144214466 25 Left 1144214458 17:13043106-13043128 CCATCATGATGGAAGGCAAAAGG No data
Right 1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144214466 Original CRISPR ATGGAGCAAGAGAAAGAGGA GGG Intergenic
No off target data available for this crispr