ID: 1144220180

View in Genome Browser
Species Human (GRCh38)
Location 17:13092645-13092667
Sequence AAACTTTTAGCCCCTACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144220180_1144220181 -7 Left 1144220180 17:13092645-13092667 CCATTAGTAGGGGCTAAAAGTTT No data
Right 1144220181 17:13092661-13092683 AAAGTTTATTCTAAATGCAATGG No data
1144220180_1144220183 5 Left 1144220180 17:13092645-13092667 CCATTAGTAGGGGCTAAAAGTTT No data
Right 1144220183 17:13092673-13092695 AAATGCAATGGGAAGTGCTATGG No data
1144220180_1144220182 -6 Left 1144220180 17:13092645-13092667 CCATTAGTAGGGGCTAAAAGTTT No data
Right 1144220182 17:13092662-13092684 AAGTTTATTCTAAATGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144220180 Original CRISPR AAACTTTTAGCCCCTACTAA TGG (reversed) Intergenic