ID: 1144220756

View in Genome Browser
Species Human (GRCh38)
Location 17:13097721-13097743
Sequence CTGGCTAAACTGACTTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144220753_1144220756 -6 Left 1144220753 17:13097704-13097726 CCCAGGACTGGGTGGTTCTGGCT No data
Right 1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG No data
1144220754_1144220756 -7 Left 1144220754 17:13097705-13097727 CCAGGACTGGGTGGTTCTGGCTA No data
Right 1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG No data
1144220747_1144220756 23 Left 1144220747 17:13097675-13097697 CCTGAACACATATCAAGGATGAT No data
Right 1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144220756 Original CRISPR CTGGCTAAACTGACTTACCA GGG Intergenic
No off target data available for this crispr