ID: 1144221375

View in Genome Browser
Species Human (GRCh38)
Location 17:13102826-13102848
Sequence CTGAATGTACCCATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144221375_1144221379 21 Left 1144221375 17:13102826-13102848 CCATTGTCCATGGGTACATTCAG No data
Right 1144221379 17:13102870-13102892 TTGGAAATTTTATTCATCTTGGG No data
1144221375_1144221378 20 Left 1144221375 17:13102826-13102848 CCATTGTCCATGGGTACATTCAG No data
Right 1144221378 17:13102869-13102891 TTTGGAAATTTTATTCATCTTGG No data
1144221375_1144221377 2 Left 1144221375 17:13102826-13102848 CCATTGTCCATGGGTACATTCAG No data
Right 1144221377 17:13102851-13102873 TCTCATGACTATAACTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144221375 Original CRISPR CTGAATGTACCCATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr