ID: 1144224609

View in Genome Browser
Species Human (GRCh38)
Location 17:13132765-13132787
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144224609_1144224617 13 Left 1144224609 17:13132765-13132787 CCCTCTTTAAAGACAAAAGGTGC No data
Right 1144224617 17:13132801-13132823 ACAAGTTGGCAGTTCGTGTGGGG No data
1144224609_1144224615 11 Left 1144224609 17:13132765-13132787 CCCTCTTTAAAGACAAAAGGTGC No data
Right 1144224615 17:13132799-13132821 TGACAAGTTGGCAGTTCGTGTGG No data
1144224609_1144224614 -1 Left 1144224609 17:13132765-13132787 CCCTCTTTAAAGACAAAAGGTGC No data
Right 1144224614 17:13132787-13132809 CTGGGGAGCATATGACAAGTTGG No data
1144224609_1144224616 12 Left 1144224609 17:13132765-13132787 CCCTCTTTAAAGACAAAAGGTGC No data
Right 1144224616 17:13132800-13132822 GACAAGTTGGCAGTTCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144224609 Original CRISPR GCACCTTTTGTCTTTAAAGA GGG (reversed) Intergenic
No off target data available for this crispr