ID: 1144224614

View in Genome Browser
Species Human (GRCh38)
Location 17:13132787-13132809
Sequence CTGGGGAGCATATGACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144224609_1144224614 -1 Left 1144224609 17:13132765-13132787 CCCTCTTTAAAGACAAAAGGTGC No data
Right 1144224614 17:13132787-13132809 CTGGGGAGCATATGACAAGTTGG No data
1144224610_1144224614 -2 Left 1144224610 17:13132766-13132788 CCTCTTTAAAGACAAAAGGTGCT No data
Right 1144224614 17:13132787-13132809 CTGGGGAGCATATGACAAGTTGG No data
1144224607_1144224614 23 Left 1144224607 17:13132741-13132763 CCAGAACTTCAGAACTGTTCTCT No data
Right 1144224614 17:13132787-13132809 CTGGGGAGCATATGACAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144224614 Original CRISPR CTGGGGAGCATATGACAAGT TGG Intergenic
No off target data available for this crispr