ID: 1144224615

View in Genome Browser
Species Human (GRCh38)
Location 17:13132799-13132821
Sequence TGACAAGTTGGCAGTTCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144224610_1144224615 10 Left 1144224610 17:13132766-13132788 CCTCTTTAAAGACAAAAGGTGCT No data
Right 1144224615 17:13132799-13132821 TGACAAGTTGGCAGTTCGTGTGG No data
1144224609_1144224615 11 Left 1144224609 17:13132765-13132787 CCCTCTTTAAAGACAAAAGGTGC No data
Right 1144224615 17:13132799-13132821 TGACAAGTTGGCAGTTCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144224615 Original CRISPR TGACAAGTTGGCAGTTCGTG TGG Intergenic
No off target data available for this crispr