ID: 1144224616

View in Genome Browser
Species Human (GRCh38)
Location 17:13132800-13132822
Sequence GACAAGTTGGCAGTTCGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144224609_1144224616 12 Left 1144224609 17:13132765-13132787 CCCTCTTTAAAGACAAAAGGTGC No data
Right 1144224616 17:13132800-13132822 GACAAGTTGGCAGTTCGTGTGGG No data
1144224610_1144224616 11 Left 1144224610 17:13132766-13132788 CCTCTTTAAAGACAAAAGGTGCT No data
Right 1144224616 17:13132800-13132822 GACAAGTTGGCAGTTCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144224616 Original CRISPR GACAAGTTGGCAGTTCGTGT GGG Intergenic
No off target data available for this crispr