ID: 1144227397

View in Genome Browser
Species Human (GRCh38)
Location 17:13162948-13162970
Sequence TGGTTATCTAAAATGCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144227397_1144227402 18 Left 1144227397 17:13162948-13162970 CCAACTAGCATTTTAGATAACCA No data
Right 1144227402 17:13162989-13163011 CAAAAAGGGAAAAATGCACCTGG No data
1144227397_1144227403 19 Left 1144227397 17:13162948-13162970 CCAACTAGCATTTTAGATAACCA No data
Right 1144227403 17:13162990-13163012 AAAAAGGGAAAAATGCACCTGGG No data
1144227397_1144227401 4 Left 1144227397 17:13162948-13162970 CCAACTAGCATTTTAGATAACCA No data
Right 1144227401 17:13162975-13162997 TTTAAAGAAGGTGACAAAAAGGG No data
1144227397_1144227400 3 Left 1144227397 17:13162948-13162970 CCAACTAGCATTTTAGATAACCA No data
Right 1144227400 17:13162974-13162996 GTTTAAAGAAGGTGACAAAAAGG No data
1144227397_1144227398 -8 Left 1144227397 17:13162948-13162970 CCAACTAGCATTTTAGATAACCA No data
Right 1144227398 17:13162963-13162985 GATAACCAGCAGTTTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144227397 Original CRISPR TGGTTATCTAAAATGCTAGT TGG (reversed) Intergenic
No off target data available for this crispr