ID: 1144232605

View in Genome Browser
Species Human (GRCh38)
Location 17:13223078-13223100
Sequence CCAAAAGAGCACCTCATATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144232605_1144232611 6 Left 1144232605 17:13223078-13223100 CCCTATATGAGGTGCTCTTTTGG No data
Right 1144232611 17:13223107-13223129 CCACACAGCTGCTAATTAGCAGG No data
1144232605_1144232613 17 Left 1144232605 17:13223078-13223100 CCCTATATGAGGTGCTCTTTTGG No data
Right 1144232613 17:13223118-13223140 CTAATTAGCAGGTCACTTGCGGG No data
1144232605_1144232614 24 Left 1144232605 17:13223078-13223100 CCCTATATGAGGTGCTCTTTTGG No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data
1144232605_1144232612 16 Left 1144232605 17:13223078-13223100 CCCTATATGAGGTGCTCTTTTGG No data
Right 1144232612 17:13223117-13223139 GCTAATTAGCAGGTCACTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144232605 Original CRISPR CCAAAAGAGCACCTCATATA GGG (reversed) Intergenic
No off target data available for this crispr