ID: 1144232607

View in Genome Browser
Species Human (GRCh38)
Location 17:13223079-13223101
Sequence ACCAAAAGAGCACCTCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144232607_1144232613 16 Left 1144232607 17:13223079-13223101 CCTATATGAGGTGCTCTTTTGGT No data
Right 1144232613 17:13223118-13223140 CTAATTAGCAGGTCACTTGCGGG No data
1144232607_1144232612 15 Left 1144232607 17:13223079-13223101 CCTATATGAGGTGCTCTTTTGGT No data
Right 1144232612 17:13223117-13223139 GCTAATTAGCAGGTCACTTGCGG No data
1144232607_1144232614 23 Left 1144232607 17:13223079-13223101 CCTATATGAGGTGCTCTTTTGGT No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data
1144232607_1144232611 5 Left 1144232607 17:13223079-13223101 CCTATATGAGGTGCTCTTTTGGT No data
Right 1144232611 17:13223107-13223129 CCACACAGCTGCTAATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144232607 Original CRISPR ACCAAAAGAGCACCTCATAT AGG (reversed) Intergenic