ID: 1144232608

View in Genome Browser
Species Human (GRCh38)
Location 17:13223105-13223127
Sequence TGCTAATTAGCAGCTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144232608_1144232613 -10 Left 1144232608 17:13223105-13223127 CCCCACACAGCTGCTAATTAGCA No data
Right 1144232613 17:13223118-13223140 CTAATTAGCAGGTCACTTGCGGG No data
1144232608_1144232615 20 Left 1144232608 17:13223105-13223127 CCCCACACAGCTGCTAATTAGCA No data
Right 1144232615 17:13223148-13223170 TGTGCTTGTGTTGTGCTTCTTGG No data
1144232608_1144232616 24 Left 1144232608 17:13223105-13223127 CCCCACACAGCTGCTAATTAGCA No data
Right 1144232616 17:13223152-13223174 CTTGTGTTGTGCTTCTTGGCTGG No data
1144232608_1144232614 -3 Left 1144232608 17:13223105-13223127 CCCCACACAGCTGCTAATTAGCA No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144232608 Original CRISPR TGCTAATTAGCAGCTGTGTG GGG (reversed) Intergenic
No off target data available for this crispr