ID: 1144232611

View in Genome Browser
Species Human (GRCh38)
Location 17:13223107-13223129
Sequence CCACACAGCTGCTAATTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144232605_1144232611 6 Left 1144232605 17:13223078-13223100 CCCTATATGAGGTGCTCTTTTGG No data
Right 1144232611 17:13223107-13223129 CCACACAGCTGCTAATTAGCAGG No data
1144232607_1144232611 5 Left 1144232607 17:13223079-13223101 CCTATATGAGGTGCTCTTTTGGT No data
Right 1144232611 17:13223107-13223129 CCACACAGCTGCTAATTAGCAGG No data
1144232604_1144232611 9 Left 1144232604 17:13223075-13223097 CCACCCTATATGAGGTGCTCTTT No data
Right 1144232611 17:13223107-13223129 CCACACAGCTGCTAATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144232611 Original CRISPR CCACACAGCTGCTAATTAGC AGG Intergenic
No off target data available for this crispr