ID: 1144232614

View in Genome Browser
Species Human (GRCh38)
Location 17:13223125-13223147
Sequence GCAGGTCACTTGCGGGTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144232605_1144232614 24 Left 1144232605 17:13223078-13223100 CCCTATATGAGGTGCTCTTTTGG No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data
1144232608_1144232614 -3 Left 1144232608 17:13223105-13223127 CCCCACACAGCTGCTAATTAGCA No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data
1144232607_1144232614 23 Left 1144232607 17:13223079-13223101 CCTATATGAGGTGCTCTTTTGGT No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data
1144232604_1144232614 27 Left 1144232604 17:13223075-13223097 CCACCCTATATGAGGTGCTCTTT No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data
1144232609_1144232614 -4 Left 1144232609 17:13223106-13223128 CCCACACAGCTGCTAATTAGCAG No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data
1144232610_1144232614 -5 Left 1144232610 17:13223107-13223129 CCACACAGCTGCTAATTAGCAGG No data
Right 1144232614 17:13223125-13223147 GCAGGTCACTTGCGGGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144232614 Original CRISPR GCAGGTCACTTGCGGGTTAG AGG Intergenic
No off target data available for this crispr