ID: 1144235685

View in Genome Browser
Species Human (GRCh38)
Location 17:13258163-13258185
Sequence TTCCTCTTCTTCTTCTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144235678_1144235685 14 Left 1144235678 17:13258126-13258148 CCCCTTCTCCTTCTCCTTCTCCT No data
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data
1144235680_1144235685 12 Left 1144235680 17:13258128-13258150 CCTTCTCCTTCTCCTTCTCCTTC 0: 539
1: 708
2: 2013
3: 7944
4: 16420
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data
1144235681_1144235685 6 Left 1144235681 17:13258134-13258156 CCTTCTCCTTCTCCTTCTCCTTC 0: 539
1: 708
2: 2013
3: 7944
4: 16420
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data
1144235677_1144235685 21 Left 1144235677 17:13258119-13258141 CCTTCTTCCCCTTCTCCTTCTCC No data
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data
1144235676_1144235685 27 Left 1144235676 17:13258113-13258135 CCTTCTCCTTCTTCCCCTTCTCC No data
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data
1144235679_1144235685 13 Left 1144235679 17:13258127-13258149 CCCTTCTCCTTCTCCTTCTCCTT 0: 25
1: 106
2: 378
3: 1647
4: 6294
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data
1144235682_1144235685 0 Left 1144235682 17:13258140-13258162 CCTTCTCCTTCTCCTTCTTCTTC 0: 210
1: 1039
2: 2175
3: 5121
4: 13989
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data
1144235683_1144235685 -6 Left 1144235683 17:13258146-13258168 CCTTCTCCTTCTTCTTCTTCCTC 0: 21
1: 328
2: 1473
3: 4063
4: 11626
Right 1144235685 17:13258163-13258185 TTCCTCTTCTTCTTCTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144235685 Original CRISPR TTCCTCTTCTTCTTCTTCAC AGG Intergenic
No off target data available for this crispr