ID: 1144243699

View in Genome Browser
Species Human (GRCh38)
Location 17:13340808-13340830
Sequence CCTCATATGGCGGAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144243699_1144243709 16 Left 1144243699 17:13340808-13340830 CCTTCCATTTCCGCCATATGAGG No data
Right 1144243709 17:13340847-13340869 CCATCCATGAATCAGAAAGTGGG No data
1144243699_1144243706 -9 Left 1144243699 17:13340808-13340830 CCTTCCATTTCCGCCATATGAGG No data
Right 1144243706 17:13340822-13340844 CATATGAGGACACAGGGAGAAGG No data
1144243699_1144243707 15 Left 1144243699 17:13340808-13340830 CCTTCCATTTCCGCCATATGAGG No data
Right 1144243707 17:13340846-13340868 ACCATCCATGAATCAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144243699 Original CRISPR CCTCATATGGCGGAAATGGA AGG (reversed) Intergenic
No off target data available for this crispr