ID: 1144244068

View in Genome Browser
Species Human (GRCh38)
Location 17:13345871-13345893
Sequence CAGGGTGAAGAGAAGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144244058_1144244068 28 Left 1144244058 17:13345820-13345842 CCAGAAAATACTGCAGTGAGTGT No data
Right 1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG No data
1144244057_1144244068 29 Left 1144244057 17:13345819-13345841 CCCAGAAAATACTGCAGTGAGTG No data
Right 1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144244068 Original CRISPR CAGGGTGAAGAGAAGGGGAA TGG Intergenic
No off target data available for this crispr