ID: 1144245857

View in Genome Browser
Species Human (GRCh38)
Location 17:13363775-13363797
Sequence TATCTATTGTCATGAAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144245854_1144245857 10 Left 1144245854 17:13363742-13363764 CCATTTACTGTTAGGAGGTGGAA No data
Right 1144245857 17:13363775-13363797 TATCTATTGTCATGAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144245857 Original CRISPR TATCTATTGTCATGAAATCC AGG Intergenic
No off target data available for this crispr