ID: 1144253981

View in Genome Browser
Species Human (GRCh38)
Location 17:13447307-13447329
Sequence TCCCTCCTCCAAGACCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144253981_1144253986 24 Left 1144253981 17:13447307-13447329 CCAGTTAGGTCTTGGAGGAGGGA No data
Right 1144253986 17:13447354-13447376 CACATTCTTTTGCTGCTGTCTGG No data
1144253981_1144253982 -2 Left 1144253981 17:13447307-13447329 CCAGTTAGGTCTTGGAGGAGGGA No data
Right 1144253982 17:13447328-13447350 GAACCAAGAGTACACCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144253981 Original CRISPR TCCCTCCTCCAAGACCTAAC TGG (reversed) Intergenic
No off target data available for this crispr