ID: 1144253983

View in Genome Browser
Species Human (GRCh38)
Location 17:13447331-13447353
Sequence GTACCTGCTTGGTGTACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144253983_1144253988 16 Left 1144253983 17:13447331-13447353 CCAAGAGTACACCAAGCAGGTAC No data
Right 1144253988 17:13447370-13447392 TGTCTGGTTTACTGGTTTACAGG No data
1144253983_1144253986 0 Left 1144253983 17:13447331-13447353 CCAAGAGTACACCAAGCAGGTAC No data
Right 1144253986 17:13447354-13447376 CACATTCTTTTGCTGCTGTCTGG No data
1144253983_1144253987 8 Left 1144253983 17:13447331-13447353 CCAAGAGTACACCAAGCAGGTAC No data
Right 1144253987 17:13447362-13447384 TTTGCTGCTGTCTGGTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144253983 Original CRISPR GTACCTGCTTGGTGTACTCT TGG (reversed) Intergenic
No off target data available for this crispr