ID: 1144253987

View in Genome Browser
Species Human (GRCh38)
Location 17:13447362-13447384
Sequence TTTGCTGCTGTCTGGTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144253984_1144253987 -3 Left 1144253984 17:13447342-13447364 CCAAGCAGGTACCACATTCTTTT No data
Right 1144253987 17:13447362-13447384 TTTGCTGCTGTCTGGTTTACTGG No data
1144253983_1144253987 8 Left 1144253983 17:13447331-13447353 CCAAGAGTACACCAAGCAGGTAC No data
Right 1144253987 17:13447362-13447384 TTTGCTGCTGTCTGGTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144253987 Original CRISPR TTTGCTGCTGTCTGGTTTAC TGG Intergenic
No off target data available for this crispr