ID: 1144253988

View in Genome Browser
Species Human (GRCh38)
Location 17:13447370-13447392
Sequence TGTCTGGTTTACTGGTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144253983_1144253988 16 Left 1144253983 17:13447331-13447353 CCAAGAGTACACCAAGCAGGTAC No data
Right 1144253988 17:13447370-13447392 TGTCTGGTTTACTGGTTTACAGG No data
1144253984_1144253988 5 Left 1144253984 17:13447342-13447364 CCAAGCAGGTACCACATTCTTTT No data
Right 1144253988 17:13447370-13447392 TGTCTGGTTTACTGGTTTACAGG No data
1144253985_1144253988 -6 Left 1144253985 17:13447353-13447375 CCACATTCTTTTGCTGCTGTCTG No data
Right 1144253988 17:13447370-13447392 TGTCTGGTTTACTGGTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144253988 Original CRISPR TGTCTGGTTTACTGGTTTAC AGG Intergenic
No off target data available for this crispr