ID: 1144255941

View in Genome Browser
Species Human (GRCh38)
Location 17:13467179-13467201
Sequence CTTCATATATATATATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144255941_1144255943 -7 Left 1144255941 17:13467179-13467201 CCTTCCTATATATATATATGAAG No data
Right 1144255943 17:13467195-13467217 TATGAAGTATATATATACATAGG No data
1144255941_1144255944 12 Left 1144255941 17:13467179-13467201 CCTTCCTATATATATATATGAAG No data
Right 1144255944 17:13467214-13467236 TAGGAAGTATATATATATATAGG No data
1144255941_1144255945 29 Left 1144255941 17:13467179-13467201 CCTTCCTATATATATATATGAAG No data
Right 1144255945 17:13467231-13467253 TATAGGAAGTATATATATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144255941 Original CRISPR CTTCATATATATATATAGGA AGG (reversed) Intergenic
No off target data available for this crispr