ID: 1144258453

View in Genome Browser
Species Human (GRCh38)
Location 17:13493680-13493702
Sequence ATCCCCTTCCTGTTTCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144258453_1144258457 -5 Left 1144258453 17:13493680-13493702 CCTCTAAGAAACAGGAAGGGGAT No data
Right 1144258457 17:13493698-13493720 GGGATTGGAAGGCATGGCTTTGG No data
1144258453_1144258458 16 Left 1144258453 17:13493680-13493702 CCTCTAAGAAACAGGAAGGGGAT No data
Right 1144258458 17:13493719-13493741 GGAGCAGACAGCTCAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144258453 Original CRISPR ATCCCCTTCCTGTTTCTTAG AGG (reversed) Intergenic
No off target data available for this crispr