ID: 1144262424

View in Genome Browser
Species Human (GRCh38)
Location 17:13535272-13535294
Sequence ACATATGTATTTTCCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144262419_1144262424 16 Left 1144262419 17:13535233-13535255 CCAATAGTGCTATACCTTGTGCC 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG 0: 1
1: 0
2: 4
3: 35
4: 266
1144262422_1144262424 2 Left 1144262422 17:13535247-13535269 CCTTGTGCCTGAAGGGAGTTTGT 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG 0: 1
1: 0
2: 4
3: 35
4: 266
1144262423_1144262424 -5 Left 1144262423 17:13535254-13535276 CCTGAAGGGAGTTTGTTAACATA 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG 0: 1
1: 0
2: 4
3: 35
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144262424 Original CRISPR ACATATGTATTTTCCCTGCA AGG Intronic
904987037 1:34560218-34560240 ACACATGTAATTTCTCTGGAAGG - Intergenic
905696552 1:39978847-39978869 ACATATGTATTTTCTCTGTAAGG - Intergenic
906428885 1:45738427-45738449 ACATAGGTATTTTCTCTGTAAGG - Intronic
906716641 1:47974575-47974597 AAAGATTTATTTTTCCTGCATGG - Intronic
908206526 1:61855977-61855999 GCATATTTATTTTCAGTGCATGG + Intronic
909961724 1:81854343-81854365 ACAAATGTAATTTCACTACAGGG - Intronic
911651342 1:100392340-100392362 ACAAACGTGTTTTTCCTGCAGGG + Intronic
914077426 1:144368272-144368294 ACAAAAGTGTTTTCCCTGAAGGG - Intergenic
914101753 1:144598233-144598255 ACAAAAGTGTTTTCCCTGAAGGG + Intergenic
914172332 1:145236812-145236834 ACAAAAGTGTTTTCCCTGAAGGG - Intergenic
914830446 1:151166997-151167019 ACAGATGTTTCTTGCCTGCACGG - Exonic
914884773 1:151575889-151575911 ACACGTGTATTTTCCATGCCAGG - Intronic
917677545 1:177334125-177334147 ACATTTGTTTTTTGGCTGCAAGG + Intergenic
919015254 1:192025200-192025222 GCATATGTATGTTCATTGCAGGG - Intergenic
919029427 1:192221568-192221590 ATATTTGTCTTTTCCCTTCAAGG - Intergenic
920742277 1:208592424-208592446 ACACAGGTATTTTCTCTGTAAGG + Intergenic
921080396 1:211734535-211734557 ACATACGTATTTTCTCTGTCGGG + Intergenic
921307449 1:213811239-213811261 ACATCTGTATCTGCTCTGCATGG + Intergenic
921363274 1:214350264-214350286 ACGAAAGCATTTTCCCTGCAGGG + Exonic
1063165139 10:3454905-3454927 AAATATGATTTTTTCCTGCAAGG - Intergenic
1064181009 10:13114633-13114655 ACATATATTTTTTCTCTGCTTGG - Intronic
1064338591 10:14466873-14466895 ACAAATGTAATGTTCCTGCAGGG - Intergenic
1065079057 10:22110114-22110136 AGATATTTATTTTCCGTGAAGGG - Intergenic
1065283433 10:24164251-24164273 ACATTTGTACTTGCCCTGCCTGG + Intronic
1065409429 10:25407588-25407610 ACATATGTTCTTTCCCTTCTTGG + Intronic
1065750227 10:28879284-28879306 AAATAGGTTTTTTCCCTGCAAGG - Intronic
1070092914 10:73306358-73306380 ACATATGAGTTTTTCCTGCTTGG - Intronic
1070248812 10:74755701-74755723 ACACATGTATTTTCTCCGGAAGG - Intergenic
1070442204 10:76457604-76457626 ACACATGGATTTTCTCTACAGGG - Intronic
1071954177 10:90739423-90739445 CCATATATATGTTCCCAGCATGG + Intergenic
1072028022 10:91483903-91483925 ACATACATATTTTCTCTGTAGGG + Intronic
1072423951 10:95313647-95313669 AGAGATGAATTTTCCCTGGAGGG - Exonic
1073852996 10:107643052-107643074 ACATATATATTTATCCTCCAGGG - Intergenic
1074350005 10:112727417-112727439 AAATTTTTTTTTTCCCTGCAGGG - Intronic
1075548763 10:123376720-123376742 AAATGTGGCTTTTCCCTGCAGGG + Intergenic
1075556010 10:123432983-123433005 CCATATGCATTTTCCATACAAGG + Intergenic
1079153001 11:17918382-17918404 CCAGATGTATTGACCCTGCAGGG - Intronic
1079589610 11:22166362-22166384 ATGTTTGTATTTTCCCTGTAAGG - Intergenic
1081750494 11:45507488-45507510 ACATATTTATCTTCCCTAAAAGG - Intergenic
1082733650 11:56831151-56831173 TCATATGTATGTTGGCTGCATGG - Intergenic
1083376145 11:62223363-62223385 GAATATGAATTTTCCCAGCAAGG - Intergenic
1084069394 11:66724481-66724503 ACATATCTATGTTACCTGCCTGG + Intronic
1085964838 11:81510252-81510274 ACATATGTTTTTTTTCTGCGTGG - Intergenic
1087181603 11:95147653-95147675 ACAGATGCATTTCCCCTGCATGG - Intergenic
1087693676 11:101351185-101351207 ATATATTTCTTTTCCCTGCCAGG + Intergenic
1087860475 11:103147879-103147901 AAATGTGTATTTACCCTGTATGG - Exonic
1087976453 11:104554726-104554748 ACACATATATTTTCTCTGCAAGG - Intergenic
1088390051 11:109304318-109304340 ACATATGTGTTTTCTCTGTAAGG - Intergenic
1088549516 11:110997414-110997436 ACTTATGTATTTTTCCTTTATGG - Intergenic
1090317419 11:125806165-125806187 CATTTTGTATTTTCCCTGCAAGG + Intergenic
1091796692 12:3301336-3301358 TCATTTGTATTCTCTCTGCAAGG - Intergenic
1093789010 12:23225255-23225277 ACAAATTTAGTTTCCCTGCTAGG - Intergenic
1093902297 12:24649881-24649903 ACATATGCATTTTCACTATAAGG + Intergenic
1096399429 12:51292937-51292959 ATACATGTATTTTCTCTGGAAGG - Intronic
1096895002 12:54812617-54812639 ACATATGTAACTAACCTGCACGG - Intergenic
1097349220 12:58529391-58529413 ACACATGTATTTTCTCTGTAAGG - Intergenic
1097805788 12:63963101-63963123 ACATTTTTATTTTCTCTCCACGG - Intronic
1100429853 12:94521688-94521710 TCATTTGTATTTTCTCAGCATGG + Intergenic
1101180729 12:102214346-102214368 ACATATGAATGTTCCCTAAAAGG + Intergenic
1101894874 12:108748768-108748790 ACACATGTATTTTCCCCATAAGG + Intergenic
1104146464 12:126038452-126038474 ACATATTCAATTTCCCTGGAAGG - Intergenic
1106040629 13:26087619-26087641 ATATATGTATTATTCCAGCATGG + Intergenic
1108742851 13:53356541-53356563 ACCAATGTATTTTCCCTTCCTGG - Intergenic
1108767303 13:53647904-53647926 ATATATGTATATTCCATACATGG - Intergenic
1109132154 13:58601090-58601112 AATCATGTATTTTCCCTGCTTGG - Intergenic
1109529283 13:63620053-63620075 ACATATGTATTTTCTCCAAATGG + Intergenic
1110148823 13:72225631-72225653 ACATATGTAACTAACCTGCATGG - Intergenic
1110443068 13:75547085-75547107 ATATGTGTATTTTCTCTGTAAGG + Intronic
1110725629 13:78819633-78819655 ATATATTTAGTTTCCATGCATGG + Intergenic
1111049838 13:82867311-82867333 ACACATGTATTTTTAATGCATGG + Intergenic
1112431218 13:99351865-99351887 ACCTCTGTGTTTTGCCTGCAAGG + Intronic
1112714357 13:102166651-102166673 ACCCACGTATTTTCCCTGTAAGG - Intronic
1113372602 13:109736837-109736859 ACATGTGCAATTTCCCTGCAAGG - Intergenic
1113568757 13:111338542-111338564 TCAGATGTAATTTCCCTGGATGG - Intronic
1116543914 14:46138191-46138213 AAATACATATTTTCTCTGCAAGG - Intergenic
1117724286 14:58657201-58657223 ACATATGCATATTGCCTGAAAGG + Intergenic
1119210230 14:72825977-72825999 CCATCTGTATTTTTCCTCCATGG - Intronic
1121608752 14:95261086-95261108 ACACATGTATTTTCTCCGCAAGG + Intronic
1121608798 14:95261574-95261596 ATAAGTGTATTTTCTCTGCAGGG - Intronic
1121809750 14:96873982-96874004 TCCTATGTAATTTACCTGCATGG + Intronic
1123145397 14:106124961-106124983 AGATATGTCTTTCCCCTGGATGG + Intergenic
1124983922 15:34586781-34586803 ACATATGTAACAACCCTGCAAGG + Intronic
1127285147 15:57526198-57526220 CCATCTTTATTTTCCTTGCAAGG - Intronic
1127337802 15:58007018-58007040 ACACATGTATTTTCTCTGTAAGG - Intronic
1127622791 15:60750753-60750775 ATATTTGTATTTTACCTTCAGGG + Intronic
1128658733 15:69482551-69482573 ACATATGTATCTTCACTCCAGGG - Intergenic
1129125179 15:73434114-73434136 ACACATGTATTTTCTCTATAAGG + Intergenic
1129947971 15:79558649-79558671 ACATATGTAACATACCTGCACGG + Intergenic
1131050577 15:89345121-89345143 ACATACGTATTTTATCTGTAAGG + Intergenic
1131758716 15:95595774-95595796 ACATAGATATATTCCCTGAAAGG + Intergenic
1134116430 16:11552378-11552400 ATTTATATAATTTCCCTGCATGG + Intronic
1134785151 16:16935574-16935596 ACATACATATTTTCTCTGAAAGG + Intergenic
1136693708 16:32056822-32056844 AGATATGTCTTTCCCCTGGATGG - Intergenic
1136794198 16:33000057-33000079 AGATATGTCTTTCCCCTGGATGG - Intergenic
1136875711 16:33854322-33854344 AGATATGTCTTTCCCCTGGATGG + Intergenic
1138737867 16:59272829-59272851 ACACATGTATTTTCTCAGTAAGG - Intergenic
1140156236 16:72429656-72429678 ACAGATGTGTTTTCTTTGCATGG + Intergenic
1140343934 16:74193919-74193941 ACACACGTATTTTCTCTGTAAGG + Intergenic
1141357354 16:83360276-83360298 ACAGATGTATTTTCCGTACGTGG - Intronic
1203096460 16_KI270728v1_random:1261738-1261760 AGATATGTCTTTCCCCTGGATGG - Intergenic
1144166705 17:12618626-12618648 ACACATGCATTTTCTCTGTAAGG - Intergenic
1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG + Intronic
1144277498 17:13688120-13688142 ATATATGGATTTTTGCTGCATGG + Intergenic
1144418476 17:15073740-15073762 ACCTATTTATTTTCTCTGAAAGG + Intergenic
1146902599 17:36598344-36598366 AAATCTGTATTTTCCCACCAAGG - Intronic
1146981888 17:37170622-37170644 ATATATGTATTTTTTCTGCTGGG + Intronic
1150965686 17:69965457-69965479 ATCTATGTATCTTCCCTGCATGG - Intergenic
1152486618 17:80598705-80598727 GAATCTGTGTTTTCCCTGCATGG + Intronic
1153266424 18:3274817-3274839 ACATATGTATTTACCTTTTAGGG + Intronic
1153910195 18:9699940-9699962 ATTTTGGTATTTTCCCTGCAGGG - Intergenic
1154013860 18:10598836-10598858 ACACACGTATTTTCTCTGTAAGG + Intergenic
1156020312 18:32592904-32592926 AGATATGTATGTTCCAGGCAGGG + Intergenic
1157537262 18:48469071-48469093 AAAGATGTATTATCCCTGCCGGG + Intergenic
1158432342 18:57400721-57400743 ACCTATGTATTCTACCTGCTGGG - Intergenic
1159859769 18:73633492-73633514 ATATATGTATTTTCTCTGTAAGG + Intergenic
1164387109 19:27781614-27781636 CTATATGTATTTTCCCTGCCAGG + Intergenic
1164539295 19:29110591-29110613 GCATATCTATTTTCTCTGCAAGG + Intergenic
1164651116 19:29891685-29891707 ACATCTGTATTGTCCCTTGAAGG + Intergenic
1166154189 19:40898440-40898462 ACAGACGTATTTCCCCTGCTTGG + Intergenic
1166173915 19:41052140-41052162 ACAGATGTATTTCCCCTGCTTGG - Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1166664084 19:44666758-44666780 AGAAGTGTATTTTCCCTGGAGGG - Intronic
1168607756 19:57773368-57773390 ACAGATGTATCCTCCCTTCATGG - Intronic
925908907 2:8558437-8558459 AGATCTGTGTTTTGCCTGCAGGG - Intergenic
926202221 2:10809939-10809961 ATATAAGAATTTTCCCTGCTGGG - Intronic
926532221 2:14062836-14062858 AAATATCTATTTTTCCTACATGG - Intergenic
926802385 2:16670277-16670299 ACACATGTATTTTCTCTGTAAGG + Intergenic
928063498 2:28138961-28138983 TCATATGCAGTTTTCCTGCATGG - Intronic
928956127 2:36870255-36870277 ACACATGTTCTTTCCCTCCATGG + Intronic
929084285 2:38152943-38152965 ACACATGTATTTTCTCTGTAAGG - Intergenic
929264485 2:39903023-39903045 ACGGATGTATATTCCCTGCCTGG - Intergenic
929511791 2:42570538-42570560 AAATATTTATTTTCCCTTGATGG + Intronic
931306135 2:61030551-61030573 ACACCTGTATTTTCTCTGTAAGG - Intronic
931615713 2:64154989-64155011 ACACATGTATTTTCTCTATAAGG + Intergenic
931627071 2:64266210-64266232 ACACACGTATTTTCCCTGTGAGG + Intergenic
932978844 2:76638100-76638122 ACATATGTAGTTACCCTATAAGG + Intergenic
933007354 2:77012949-77012971 ACATCTGTATTTTCCTTGGTAGG - Intronic
933596276 2:84286610-84286632 ACATATGTATTTTCTCCATAAGG + Intergenic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
934875449 2:97915126-97915148 CCATCTGTATTTCCCCTTCAGGG + Intronic
935467832 2:103420380-103420402 ACATAGGTATCCTACCTGCAAGG - Intergenic
936403593 2:112183979-112184001 ACATCTGTATTTTCCCTAAGTGG - Intronic
937331828 2:121035771-121035793 ACATATAAATTTTCTCTGTAAGG + Intergenic
938612836 2:132966772-132966794 ACACATGTATTTTATCTGTAGGG + Intronic
941840536 2:170078111-170078133 TCATTTGTATTTTCTCAGCATGG + Intronic
943114153 2:183645653-183645675 ACATATTTATTTGCCTTGCTGGG - Intergenic
943341593 2:186688916-186688938 ACACTTGTATTTTGCCTCCAAGG - Intergenic
943615031 2:190083049-190083071 ACATATTTATTTTTTGTGCATGG + Intronic
946357697 2:219198890-219198912 AGATTTGCATCTTCCCTGCAGGG + Intronic
946513908 2:220390932-220390954 ACATACATATTTTCCCTGTAAGG - Intergenic
1169717441 20:8636160-8636182 GCACATGTATTCTACCTGCAAGG - Intronic
1169842638 20:9956933-9956955 AAAAATGTATTTTCCCGGCTGGG + Intergenic
1170145323 20:13167473-13167495 ACATATGCATTTTTCCTTTACGG + Exonic
1170171064 20:13413087-13413109 ACTTATTTATTTTAACTGCATGG + Intronic
1171066371 20:22019683-22019705 AACTATATATCTTCCCTGCATGG - Intergenic
1171340637 20:24424697-24424719 ACAAATGTGTTTTCCAGGCAAGG + Intergenic
1173402269 20:42736203-42736225 GCCCATGTATTTTCCCTGCAGGG - Intronic
1174082189 20:47978501-47978523 AAGTATGTATTTTGCTTGCAGGG - Intergenic
1174134294 20:48368285-48368307 AAGTATGTATTTTGCTTGCAGGG + Intergenic
1174324519 20:49768580-49768602 ACATGTTTACTTTCCCTGCCTGG - Intergenic
1174726671 20:52869895-52869917 GCATACCTATTTCCCCTGCAAGG + Intergenic
1175295487 20:57905961-57905983 ACCTATGTATTTTCCCTTTGTGG - Intergenic
1178256481 21:31057140-31057162 ACATCTGTTTCTGCCCTGCATGG - Intergenic
1178315211 21:31561143-31561165 ATATATGTATTTCCCCTAGATGG - Intergenic
1179930123 21:44563904-44563926 ACATACATATTTTCTCTGTAAGG + Intronic
1181903178 22:26171499-26171521 ACAATTTTTTTTTCCCTGCAAGG - Intronic
949179204 3:1106817-1106839 TCACATGTATTTTTACTGCATGG + Intronic
949259975 3:2094674-2094696 ACACATGTATTTTCTCTGTGAGG - Intergenic
950691398 3:14660968-14660990 ATATCTGTATATGCCCTGCAGGG + Intronic
951045207 3:18029989-18030011 ACATACTTATTTGCCCTGTATGG - Intronic
951893465 3:27588078-27588100 AAATATGTATTATCCCAGCCTGG + Intergenic
952195099 3:31067234-31067256 ACATTTGCATTTGCCCTGCAGGG - Intergenic
952264581 3:31773288-31773310 ACATAAATATTTTCTCTGTAAGG + Intronic
953133651 3:40164334-40164356 ACATATATATATTCCTTTCAGGG + Intronic
953658163 3:44870631-44870653 ACAAATGTGTTTACACTGCATGG - Intronic
955826114 3:62949994-62950016 ACAGATATATTTTCACTTCAGGG + Intergenic
956186180 3:66564519-66564541 ACACACGTATTTTCTCTGTAAGG + Intergenic
958574347 3:95928373-95928395 ATATATATTTTTTCCCTGCCTGG - Intergenic
959634892 3:108554844-108554866 TCCTAAGTATTTTACCTGCAAGG + Intronic
959666738 3:108931383-108931405 ACATAAATATTTTCACTGTATGG + Intronic
959996630 3:112687692-112687714 CAATATGTTTTTTCCCAGCATGG - Intergenic
960517253 3:118616072-118616094 ACATATTTATTTTACTTGCCTGG - Intergenic
960756948 3:121024599-121024621 ATATTTTTATTTTACCTGCATGG - Intronic
960795387 3:121481081-121481103 ACAGATGTTTTTTCACAGCAAGG - Intronic
961995959 3:131243396-131243418 AAATGTTTATTTTCCCTGTATGG - Intronic
962360238 3:134735371-134735393 ACACATGTATTTTCTCTGTAAGG + Intronic
962526216 3:136239960-136239982 ACATATGTATTTTCAAGGCTGGG - Intergenic
963970450 3:151423582-151423604 CCAAATATATTTTCCCAGCAAGG - Intronic
965162993 3:165158997-165159019 ATATATATATATTCCCTACAGGG - Intergenic
965752575 3:171991359-171991381 ACGTAAGTATTTGCTCTGCAAGG + Intergenic
965852095 3:173040330-173040352 GCCTATGTATTTACCCTGCAAGG + Intronic
966349666 3:179018472-179018494 AAATATGGATTTTCCCTCCAAGG + Exonic
967023456 3:185543303-185543325 ACACATGTATTTTCTCTCTAAGG - Intronic
969949613 4:10821620-10821642 ACCCCTGTATTTTCCGTGCATGG + Intergenic
970124371 4:12792705-12792727 CCACATGTTTTTTCCCTGAAGGG + Intergenic
970861451 4:20707863-20707885 TCATATTGATTTTACCTGCAAGG - Exonic
972799979 4:42464045-42464067 ACATGTGTGTTATCCCTCCATGG + Intronic
974299388 4:60043297-60043319 ACATATGCAGTTTCATTGCATGG + Intergenic
974372074 4:61030289-61030311 AAATATGTATTCTCCCTTCGAGG - Intergenic
975134912 4:70865488-70865510 ATATATGTATATACACTGCAAGG + Intergenic
976102191 4:81577189-81577211 ACATGTAAATTTCCCCTGCATGG - Intronic
976346101 4:84003360-84003382 ACAAATGTCTTTTCCAGGCATGG - Intergenic
976399486 4:84591536-84591558 AATTATGGACTTTCCCTGCATGG + Intronic
977998897 4:103531231-103531253 ACATATGTAACATACCTGCATGG + Intergenic
978045742 4:104124825-104124847 ACATTTGTTATTTCCCAGCAAGG - Intergenic
980773995 4:137415640-137415662 CCATATATATATTCCTTGCAAGG + Intergenic
980819398 4:137994094-137994116 ACATATGTATTTCTCTTCCATGG + Intergenic
980823148 4:138042033-138042055 ATATATGTATTTTTTCTGTAAGG + Intergenic
981107296 4:140895403-140895425 ACATATGTTTTTTGCTTCCAAGG - Intronic
981289908 4:143062763-143062785 AAATATGTATTTTCCATGGATGG - Intergenic
981396096 4:144251894-144251916 ACATATGTAATTTGGGTGCATGG - Intergenic
981461993 4:145023865-145023887 ACAGATGAATTTTCCATGAAAGG - Intronic
983159951 4:164400286-164400308 AAATATGAATTTTACCTTCAAGG + Intergenic
984883836 4:184432488-184432510 ATATACGTATTTTCCCTGTAAGG - Intronic
985810812 5:2083174-2083196 ACATAGCTACTTTCCCTTCATGG + Intergenic
986113650 5:4748067-4748089 AAATATGTAGTTTCAGTGCAGGG - Intergenic
986143445 5:5053082-5053104 TCATATGTATATTACCTGTATGG - Intergenic
990715351 5:58630217-58630239 CCAAATATATTTTGCCTGCAAGG - Intronic
991295589 5:65076684-65076706 GCACATGTATTTCCCCTGCTTGG - Intergenic
992079527 5:73221506-73221528 ACATATGTATCTGACTTGCATGG + Intergenic
992863399 5:80934680-80934702 ACTCATCTATTTTCCCTGCAGGG - Intergenic
993058758 5:83013863-83013885 ACATTTGTACTTTCCTTCCAAGG - Intergenic
993185698 5:84616655-84616677 ACATATATATTTACCTGGCAGGG + Intergenic
994502946 5:100603195-100603217 ACATAAGTATTCACTCTGCAAGG - Intergenic
996756379 5:126939926-126939948 ACACACGTATTTTCTCTACAAGG + Intronic
997168131 5:131684020-131684042 ACACATGTATTTTTTCTGTAAGG + Intronic
998371230 5:141662833-141662855 ACACATGTATTTTCTCTGTAAGG - Intronic
998480088 5:142455662-142455684 ACACATGTATTTTCTTTGCAAGG - Intergenic
999725304 5:154431926-154431948 ATACATATATTTTCCCTGTAAGG + Intergenic
999813131 5:155147431-155147453 ATATGCATATTTTCCCTGCAGGG - Intergenic
1000579630 5:163019552-163019574 ACATAAGTCTTTTCCCTAAATGG + Intergenic
1000727999 5:164796671-164796693 CTATATGGATCTTCCCTGCATGG + Intergenic
1000977426 5:167780575-167780597 ACACATGTATTTCCTCTGTAAGG - Intronic
1001972339 5:175966943-175966965 ATATATGTCTTCTCCCCGCAGGG + Intronic
1002245099 5:177876834-177876856 ATATATGTCTTCTCCCCGCAGGG - Intergenic
1004064561 6:12230461-12230483 ACGCATGTATTTTCTCTGTAAGG + Intergenic
1005313078 6:24577623-24577645 CTACATGTCTTTTCCCTGCAAGG - Intronic
1007583192 6:42971710-42971732 ACATAGTTCTTTTCCCCGCAAGG - Intronic
1008364115 6:50655815-50655837 AAATATCTATTTTCCCTACAAGG + Intergenic
1008955285 6:57208981-57209003 ACATATTTATTTTTTCTGTAAGG + Intronic
1009804214 6:68581307-68581329 ACATGTGTATATTCCTTGTAGGG - Intergenic
1010564523 6:77393290-77393312 ACATATGTATTTCCTCTATAAGG + Intergenic
1010863533 6:80943336-80943358 TGATATGTATTTGACCTGCAGGG + Intergenic
1011441100 6:87388227-87388249 ACATATATAATTTTACTGCAAGG + Intronic
1011988013 6:93474477-93474499 ACATAACTATTTTCCAGGCAGGG + Intergenic
1013258889 6:108417457-108417479 TTCTATGTCTTTTCCCTGCATGG - Intronic
1013824211 6:114191880-114191902 ACATATGTATCTCCCCAACACGG + Intronic
1014741313 6:125150692-125150714 ACATATATATTTTCTCTCTAAGG - Intronic
1014803385 6:125802288-125802310 AAATATGTATTTCACCTTCATGG + Intronic
1015043593 6:128751718-128751740 AGATATTTATTTTGCCTTCAGGG + Intergenic
1016273449 6:142318917-142318939 ACATATCTATCTCCCCTGCTGGG - Intronic
1016630331 6:146222200-146222222 AAATATGTATTGTCCCTCCAAGG - Intronic
1018232808 6:161691585-161691607 ACACATGTATTTTCTCCACAAGG + Intronic
1018236306 6:161727251-161727273 ACTAATGCATTTGCCCTGCAGGG - Intronic
1020789404 7:12607357-12607379 ACATATGTACATGCCCAGCAGGG - Intronic
1024832816 7:53481614-53481636 ATGTATGCAATTTCCCTGCAAGG + Intergenic
1026578419 7:71593943-71593965 ACATTTGTAATTTCCCTGCGTGG - Intronic
1028293507 7:89097961-89097983 GAATATGTATTTTACCTGCTAGG - Intronic
1028592209 7:92509571-92509593 AAATATTTATATTCCCTGGATGG - Intronic
1028897534 7:96059210-96059232 ACACATGTATTTTTCCAGTAGGG + Intronic
1032609740 7:133399820-133399842 ACATAGCTATCTTCCCTGCTTGG - Intronic
1032937248 7:136747130-136747152 TAATATCTCTTTTCCCTGCATGG - Intergenic
1033496789 7:141906874-141906896 ACACATGCATTTTCTCTGTAAGG + Intergenic
1034068481 7:148159595-148159617 ACATAAATATATTCCCTGGAGGG - Intronic
1034985699 7:155513415-155513437 ACATTTGTGTTTTCCCCCCAAGG - Intronic
1035826934 8:2654645-2654667 CCATATGTAATTTCGCTGCATGG - Intergenic
1036138854 8:6187777-6187799 AAATTTGCCTTTTCCCTGCAGGG + Intergenic
1036223010 8:6936756-6936778 ACATATCTATTTCCTTTGCATGG - Exonic
1036816118 8:11904078-11904100 ATATATGTATTTTACATACATGG + Intergenic
1039142013 8:34401133-34401155 ACATATGATTATTCCCTGCCAGG + Intergenic
1039568628 8:38568591-38568613 AAAACTGTGTTTTCCCTGCAGGG - Intergenic
1041115849 8:54535844-54535866 ACATATGTATTTTCTCTACAAGG + Intergenic
1042209493 8:66365508-66365530 ACACATGTATTTTCCCCGTAGGG - Intergenic
1042904064 8:73755499-73755521 ACAAATTTATTTCCACTGCAAGG - Intronic
1043179903 8:77075826-77075848 ACATATGTATTTCCTCCACAGGG - Intergenic
1043759450 8:84049104-84049126 AGATCTGAATTTTACCTGCAGGG - Intergenic
1046428009 8:114081172-114081194 ACACATGTATTTTCTCTATAAGG + Intergenic
1047242372 8:123102923-123102945 ACACATGTATTTTCTCTGTAAGG - Intronic
1047859274 8:128946828-128946850 ACAAATGTATTGTTCTTGCAGGG - Intergenic
1048459453 8:134609194-134609216 ACATATATATGTTACTTGCAAGG + Intronic
1048687582 8:136921100-136921122 ACATTTGTATTTTCAGTGCCTGG + Intergenic
1049503597 8:142982500-142982522 ACATGTTTATTTTCTGTGCAGGG - Intergenic
1050250630 9:3740384-3740406 AAATATGTATTTTCCTTTTACGG + Intergenic
1050844435 9:10196615-10196637 TCATATGAATTTTCCCTTGAAGG - Intronic
1051670225 9:19502795-19502817 AAATATATATTTACCCAGCAAGG - Intergenic
1052207355 9:25858502-25858524 ACATATGTATGATCTCTCCAAGG - Intergenic
1053539214 9:38956419-38956441 ACATCTGTAATTTACCTGAACGG + Intergenic
1054626925 9:67407502-67407524 ACATCTGTAATTTACCTGAACGG - Intergenic
1054766035 9:69043338-69043360 ACACATGCATTTTCTCTGTAAGG - Intronic
1054852172 9:69858524-69858546 ACACATGTGTTTTCTCTGAAAGG - Intronic
1056081698 9:83101930-83101952 ACACATATATTTTCTCTGTAAGG + Intergenic
1058185652 9:101851397-101851419 AAAAATGTAATTTTCCTGCAAGG - Intergenic
1058947228 9:109869168-109869190 ACATATGTTTATTCCCTGACTGG - Intronic
1059589617 9:115644534-115644556 ACATGAGTAATTCCCCTGCATGG + Intergenic
1059887800 9:118766428-118766450 ACATATGTTTTTTCCCTGTAAGG - Intergenic
1062584354 9:137242204-137242226 ACACACGTAATCTCCCTGCAGGG + Intronic
1185827605 X:3267077-3267099 ACAAAAGTATTTTCCGTGTAAGG + Intergenic
1186265247 X:7825548-7825570 AGACATGTATTTTCTCTGTAAGG - Intergenic
1186363179 X:8863852-8863874 ACATATCCATTTTCTCTGAAAGG + Intergenic
1186416521 X:9387729-9387751 AAAGATATATTTTCTCTGCAGGG - Intergenic
1190900199 X:54664880-54664902 ACATATGTAACTAACCTGCACGG - Intergenic
1193641539 X:84014973-84014995 ATATATATATTTTACCTTCATGG + Intergenic
1194654795 X:96559440-96559462 ACATCTGAATTTTCACTGCAAGG - Intergenic
1195029322 X:100910870-100910892 TCATTTGTATTTTCTCAGCATGG - Intergenic
1195153065 X:102094038-102094060 ACATATTTGCCTTCCCTGCATGG - Intergenic
1196351012 X:114729727-114729749 ACACATATATTATCCCTGCCTGG + Intronic