ID: 1144262528

View in Genome Browser
Species Human (GRCh38)
Location 17:13536551-13536573
Sequence GTTGGATCTTCTCTGTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144262528_1144262533 27 Left 1144262528 17:13536551-13536573 CCATAATACAGAGAAGATCCAAC 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1144262533 17:13536601-13536623 CGCCCACGTTTAACACCCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 27
1144262528_1144262534 28 Left 1144262528 17:13536551-13536573 CCATAATACAGAGAAGATCCAAC 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144262528 Original CRISPR GTTGGATCTTCTCTGTATTA TGG (reversed) Intronic