ID: 1144262528 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:13536551-13536573 |
| Sequence | GTTGGATCTTCTCTGTATTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 126 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 5, 4: 119} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144262528_1144262533 | 27 | Left | 1144262528 | 17:13536551-13536573 | CCATAATACAGAGAAGATCCAAC | 0: 1 1: 0 2: 1 3: 5 4: 119 |
||
| Right | 1144262533 | 17:13536601-13536623 | CGCCCACGTTTAACACCCCTAGG | 0: 1 1: 0 2: 0 3: 3 4: 27 |
||||
| 1144262528_1144262534 | 28 | Left | 1144262528 | 17:13536551-13536573 | CCATAATACAGAGAAGATCCAAC | 0: 1 1: 0 2: 1 3: 5 4: 119 |
||
| Right | 1144262534 | 17:13536602-13536624 | GCCCACGTTTAACACCCCTAGGG | 0: 1 1: 0 2: 0 3: 2 4: 25 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144262528 | Original CRISPR | GTTGGATCTTCTCTGTATTA TGG (reversed) | Intronic | ||