ID: 1144262530

View in Genome Browser
Species Human (GRCh38)
Location 17:13536573-13536595
Sequence AGTTAGCAACATTAATGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144262530_1144262534 6 Left 1144262530 17:13536573-13536595 CCTCACCATTAATGTTGCTAACT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262530_1144262533 5 Left 1144262530 17:13536573-13536595 CCTCACCATTAATGTTGCTAACT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1144262533 17:13536601-13536623 CGCCCACGTTTAACACCCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144262530 Original CRISPR AGTTAGCAACATTAATGGTG AGG (reversed) Intronic