ID: 1144262531

View in Genome Browser
Species Human (GRCh38)
Location 17:13536578-13536600
Sequence TGGTCAGTTAGCAACATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144262531_1144262533 0 Left 1144262531 17:13536578-13536600 CCATTAATGTTGCTAACTGACCA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1144262533 17:13536601-13536623 CGCCCACGTTTAACACCCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 27
1144262531_1144262534 1 Left 1144262531 17:13536578-13536600 CCATTAATGTTGCTAACTGACCA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262531_1144262540 28 Left 1144262531 17:13536578-13536600 CCATTAATGTTGCTAACTGACCA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1144262540 17:13536629-13536651 AGCTGCTGATCACTTCCAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144262531 Original CRISPR TGGTCAGTTAGCAACATTAA TGG (reversed) Intronic