ID: 1144262534

View in Genome Browser
Species Human (GRCh38)
Location 17:13536602-13536624
Sequence GCCCACGTTTAACACCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144262531_1144262534 1 Left 1144262531 17:13536578-13536600 CCATTAATGTTGCTAACTGACCA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262528_1144262534 28 Left 1144262528 17:13536551-13536573 CCATAATACAGAGAAGATCCAAC 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262529_1144262534 10 Left 1144262529 17:13536569-13536591 CCAACCTCACCATTAATGTTGCT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262530_1144262534 6 Left 1144262530 17:13536573-13536595 CCTCACCATTAATGTTGCTAACT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144262534 Original CRISPR GCCCACGTTTAACACCCCTA GGG Intronic