ID: 1144262534

View in Genome Browser
Species Human (GRCh38)
Location 17:13536602-13536624
Sequence GCCCACGTTTAACACCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144262531_1144262534 1 Left 1144262531 17:13536578-13536600 CCATTAATGTTGCTAACTGACCA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262529_1144262534 10 Left 1144262529 17:13536569-13536591 CCAACCTCACCATTAATGTTGCT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262528_1144262534 28 Left 1144262528 17:13536551-13536573 CCATAATACAGAGAAGATCCAAC 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25
1144262530_1144262534 6 Left 1144262530 17:13536573-13536595 CCTCACCATTAATGTTGCTAACT 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144262534 Original CRISPR GCCCACGTTTAACACCCCTA GGG Intronic
903769208 1:25753525-25753547 GCCGGCGTTCAACACCCCCACGG + Exonic
909528990 1:76659918-76659940 ACACCTGTTTAACACCCCTAGGG - Intergenic
1063124669 10:3127958-3127980 ACCCAAGTTTAACACCCATTGGG - Intronic
1065428850 10:25633246-25633268 GGTCAGATTTAACACCCCTAGGG + Intergenic
1075795429 10:125116492-125116514 TCCCACTTTTAGCACCCCCATGG - Intronic
1089305482 11:117523822-117523844 GCCCACGTTGAATAACCCTCAGG + Intronic
1089803280 11:121057039-121057061 TCCCACTTTTAAAACCTCTATGG - Intronic
1089929534 11:122296405-122296427 GCCAATGTTTAACACTTCTATGG + Intergenic
1108900736 13:55404432-55404454 ACCCACCTTCATCACCCCTAGGG - Intergenic
1112234428 13:97622707-97622729 GCCCACGTTTAATATCCTTTGGG - Intergenic
1125361224 15:38866728-38866750 TCCCACGGTATACACCCCTACGG + Intergenic
1130704856 15:86223637-86223659 GCCCTCTTTTAACTGCCCTATGG + Intronic
1131878255 15:96834172-96834194 CCCCCCATTTCACACCCCTACGG - Intergenic
1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG + Intronic
1157126022 18:44956879-44956901 GCCCACTTCTAACATACCTAGGG + Intronic
927125004 2:20005966-20005988 GCCCTCTTCTAACATCCCTAAGG - Exonic
927337716 2:21944521-21944543 GCCCAGTTTTCACGCCCCTAAGG + Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
977172044 4:93775082-93775104 TCCAGCGTTTAACACACCTAAGG + Intergenic
979480294 4:121208683-121208705 ACCCACTTTTAACAGCCCAATGG - Intronic
982983236 4:162168452-162168474 GTCCACATTTAACATCCCTAAGG - Intergenic
1001660645 5:173390198-173390220 GCCCACATTTTTCACCCCTGGGG - Intergenic
1028911216 7:96209468-96209490 ACACATATTTAACACCCCTAAGG + Intronic
1039965887 8:42283458-42283480 TCCCACGTTTAAGAACCCTTGGG - Intronic
1040289754 8:46118219-46118241 GCCCACCTGAAACAGCCCTAGGG + Intergenic
1054739314 9:68788702-68788724 GCTCACGTTTAGGACCCCTTTGG + Intronic
1060280889 9:122214593-122214615 GACCACGTCTTACAGCCCTAAGG + Intronic
1189437018 X:41001959-41001981 TCCCAAGTTCAACACCCCCAGGG - Intergenic