ID: 1144263315

View in Genome Browser
Species Human (GRCh38)
Location 17:13544544-13544566
Sequence ACAGCCCCAGCCTCTTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144263312_1144263315 -7 Left 1144263312 17:13544528-13544550 CCCTGCGCCGTCTGGCACAGCCC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG 0: 1
1: 0
2: 4
3: 27
4: 226
1144263313_1144263315 -8 Left 1144263313 17:13544529-13544551 CCTGCGCCGTCTGGCACAGCCCC 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG 0: 1
1: 0
2: 4
3: 27
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144263315 Original CRISPR ACAGCCCCAGCCTCTTTGTG TGG Intronic
900385043 1:2406684-2406706 ACACCCCCAGCCCCCATGTGTGG + Intronic
900599051 1:3495357-3495379 ACAGCCACAGCCTCTTGGCCTGG - Intronic
900891880 1:5455262-5455284 CCAGCCCCGGCCTCTCAGTGTGG + Intergenic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
901003784 1:6161821-6161843 CCAGCCCCAGCCTCTGTCCGTGG - Intronic
901442292 1:9285722-9285744 ACAGCCCCCGCCTCTTGAGGTGG - Intergenic
902288190 1:15419961-15419983 AAAGCCCCAGCATCTCTGGGAGG - Intronic
902704624 1:18196075-18196097 GAAGCCCCAGCCTCTTCATGTGG - Intronic
903151867 1:21415403-21415425 ACGGCCCCATCCTATTTGTCTGG + Intergenic
904290766 1:29484655-29484677 CCAGCCCCAGCCTCCTCATGGGG - Intergenic
905280588 1:36846579-36846601 ACAGCCCCAGCCTGTCTGGGAGG - Intronic
905940808 1:41861730-41861752 AAAGCCCAAGCTTCTCTGTGTGG - Intronic
906793259 1:48677087-48677109 CCAGCCCCAGCCACTTACTGGGG - Intronic
908246027 1:62228341-62228363 GCAGCCGCTTCCTCTTTGTGGGG + Intergenic
912542979 1:110430984-110431006 TCAGCCCCAACCTCTCTCTGAGG + Intergenic
912828536 1:112929249-112929271 CCAGCCCCAGCCTCCATCTGGGG + Exonic
913531017 1:119734388-119734410 ACAGTCCCAGCATCATTGTGTGG + Intronic
913988375 1:143585884-143585906 ACAGTCCCACCCTATTTGTCTGG + Intergenic
914421258 1:147530201-147530223 ACAGCCCCAGCCTATCTCTGGGG + Intergenic
919834966 1:201567233-201567255 ACATCCCCACCCTCTTCATGGGG + Intergenic
1066401761 10:35083605-35083627 ATGCCCCCACCCTCTTTGTGGGG - Intronic
1066673163 10:37860772-37860794 AAAGCCACAACCTGTTTGTGGGG - Intergenic
1067044459 10:42976432-42976454 GCAGCCCCTGCCCCTTGGTGGGG - Intergenic
1067272180 10:44802143-44802165 GCAGCCCCAGCCTGTCTTTGAGG - Intergenic
1068644429 10:59450153-59450175 CCAGCCCCTTCCTTTTTGTGAGG + Intergenic
1070769032 10:79071567-79071589 TCAGCCCCGGCTGCTTTGTGAGG + Intronic
1071524665 10:86351467-86351489 CCAGCCCCAGCCACCTTGTAGGG - Intronic
1073083283 10:100873171-100873193 ACAGGCCCAGCCTCCTTGACGGG - Intergenic
1074185099 10:111094297-111094319 TCAGCTCCAGGCTCTTTGTGGGG + Intergenic
1074823956 10:117201525-117201547 ACAGCACCCACCTCTTGGTGAGG - Intronic
1075329697 10:121564687-121564709 ACAATCCCAGGCTCTTTGCGAGG - Intronic
1075393729 10:122112564-122112586 TCACCCCCAGCTTCTTTCTGAGG + Intronic
1075467661 10:122663662-122663684 TCAGCCACAGCCTCTGTGTCAGG - Intergenic
1075812137 10:125231938-125231960 GCAACCCCAAGCTCTTTGTGAGG - Intergenic
1076195765 10:128516782-128516804 ACAGCCCCAGACTCTGGTTGTGG - Intergenic
1076819646 10:132931946-132931968 GAAGGCCCAGCCTCTGTGTGTGG - Intronic
1076819660 10:132932004-132932026 GGAGGCCCAGCCTCTGTGTGGGG - Intronic
1076819768 10:132932400-132932422 GAAGGCCCAGCCTCTGTGTGTGG - Intronic
1077298980 11:1838554-1838576 ACAGCCACAGCCTCTCCCTGCGG - Intergenic
1078421542 11:11216725-11216747 CCAGCCCCTGCCTCTGTATGTGG + Intergenic
1079204192 11:18399714-18399736 ATAGTCCCAGTTTCTTTGTGAGG - Intronic
1079427045 11:20353377-20353399 ACAGCACCAACCTCATTGGGTGG - Intergenic
1082997422 11:59265039-59265061 ACAGTCTCAGCCACTTTGAGAGG + Intergenic
1084471294 11:69360710-69360732 ACAGCCCCAGGCACTATGGGAGG - Intronic
1084944568 11:72631818-72631840 AAACCCCCAGCCTCTCTGAGGGG + Intronic
1086484745 11:87286578-87286600 ACAGCCCCAGCCTCTCTGACGGG - Intronic
1089128897 11:116196698-116196720 TCTGCCCCTGCCTCTTTCTGGGG - Intergenic
1089161984 11:116445401-116445423 ACACCGCCAGACTCTTTTTGGGG + Intergenic
1089961123 11:122618046-122618068 ACACCCACAGCCTGTTTCTGTGG - Intergenic
1091563490 12:1631166-1631188 AGAGGCCGAGCTTCTTTGTGGGG + Intronic
1092077463 12:5685486-5685508 CCAGCCCCAGGCTCTTCCTGTGG - Intronic
1095338998 12:41065740-41065762 ACAGCACCATCCACTTGGTGAGG + Intronic
1096196449 12:49651884-49651906 ACAGGGGCAGCCTCTTTGTGGGG - Intronic
1097125222 12:56769052-56769074 ACAGCCCCATCCTATCTTTGGGG - Intronic
1097951143 12:65429348-65429370 ACTCCCCCAAGCTCTTTGTGTGG - Intronic
1101042181 12:100767866-100767888 ACGGACCCAGCCTCCATGTGAGG - Intronic
1102031427 12:109742054-109742076 CCTGCCCCAGCCTCTTTCTGTGG - Intronic
1104018988 12:124979245-124979267 ACAGTCCCAGGCTCTTTGGGAGG + Intronic
1104773177 12:131377314-131377336 ACAGCACCAAGCTATTTGTGAGG + Intergenic
1105776808 13:23669958-23669980 AGAGCAGCAACCTCTTTGTGGGG - Intronic
1106421592 13:29590104-29590126 TCAACTCCAGCCACTTTGTGGGG + Intronic
1112200180 13:97267146-97267168 ACAGCCCCAGCTTGTCTGAGAGG + Intronic
1115012448 14:28565699-28565721 AGAGGCCCAGCTTCTTTTTGTGG - Intergenic
1119656285 14:76419598-76419620 ACAGCCCCAGCTCCTGTGAGAGG - Intronic
1119721632 14:76895464-76895486 CCAGCCCCAGCCTTATTGTAAGG - Intergenic
1121467547 14:94125822-94125844 ACAGCTCCAGCCTCCCTGTCTGG - Intergenic
1122773599 14:104107703-104107725 ACAGGCCCAGCCTGTGCGTGTGG + Intronic
1122874505 14:104657434-104657456 ACAGCCCCTGCCTCTTGACGAGG - Intergenic
1202933677 14_KI270725v1_random:63747-63769 CCTGCCTCAGCCTCTTTGAGTGG - Intergenic
1123501839 15:20893316-20893338 ACAGCCCCAGCCTCTACCTAAGG - Intergenic
1123559092 15:21467015-21467037 ACAGCCCCAGCCTCTACCTAAGG - Intergenic
1123595323 15:21904296-21904318 ACAGCCCCAGCCTCTACCTAAGG - Intergenic
1125673062 15:41487187-41487209 CCAGCCCCAGCCTCTTTTCCTGG - Intergenic
1125833552 15:42732357-42732379 GCAGCCACAGCCACTTTGTTCGG - Exonic
1129110950 15:73336759-73336781 ACAGCCCCAACCTCTTGATGAGG + Intronic
1130096904 15:80862736-80862758 ACAGCCACAGCCTCTCACTGGGG - Intronic
1132027869 15:98418136-98418158 CCAGCCACAGCCGCTCTGTGGGG + Intergenic
1202967441 15_KI270727v1_random:194174-194196 ACAGCCCCAGCCTCTACCTAAGG - Intergenic
1132593103 16:735037-735059 AAAGCCCCAGCCCCACTGTGGGG + Intronic
1133211137 16:4264019-4264041 GCAGCCCCGGCCTCTTCCTGAGG + Intronic
1134043976 16:11088109-11088131 ACAGCCCCAGTCCCTCAGTGCGG + Intronic
1134502175 16:14777790-14777812 CCAGCCCCAGGGTCTTTGTGGGG + Intronic
1134578385 16:15351103-15351125 CCAGCCCCAGGGTCTTTGTGGGG - Intergenic
1134724204 16:16406441-16406463 CCAGCCCCAGGGTCTTTGTGGGG + Intergenic
1134943226 16:18305428-18305450 CCAGCCCCAGGGTCTTTGTGGGG - Intergenic
1136638946 16:31545742-31545764 CCACACCCAGCCTATTTGTGGGG - Intergenic
1137563791 16:49520758-49520780 CCAGCCCCAGCTTCTGTGTAGGG + Intronic
1138128447 16:54457571-54457593 CCTGCCCCAGCTTCTTTGGGAGG + Intergenic
1139342236 16:66275128-66275150 GCAGCACCACCCTCTTGGTGCGG + Intergenic
1139493612 16:67300636-67300658 AGAAACCCATCCTCTTTGTGGGG - Intronic
1139661330 16:68422937-68422959 ACAGCCCCAGCCTGATTTAGAGG + Intronic
1139969888 16:70767538-70767560 ACAGCCTGAGCCTCATAGTGGGG + Intronic
1140222843 16:73056807-73056829 ACTGCCCAAGCCTCTTTCGGAGG + Intronic
1141589016 16:85055212-85055234 CCGCCCCCAGCCTCTTTTTGTGG + Intronic
1142717614 17:1755557-1755579 ACAGCGCCAGCCTCCTGGTTTGG + Intergenic
1143096368 17:4480616-4480638 GCAGAGCCAGGCTCTTTGTGGGG + Intronic
1143466120 17:7137847-7137869 CCAGCCCCAGCCTCTCTGAGGGG + Intergenic
1143483955 17:7242684-7242706 TCAGCCCCAGCTTCCTTGAGGGG - Exonic
1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG + Intronic
1144783785 17:17820797-17820819 TCAGCCCCAGCCTAGCTGTGGGG - Intronic
1145263063 17:21366157-21366179 ACACCCCCTGCCTCTTAGGGAGG - Intergenic
1146448746 17:32954759-32954781 TCAGCCCCACCTTCTTGGTGAGG - Intergenic
1146943208 17:36858162-36858184 ACAGCCCCAGGCTCTGTCTGGGG - Intergenic
1147136350 17:38436209-38436231 GCAACCCCAGCCTGGTTGTGTGG - Intronic
1147443895 17:40463315-40463337 GCAGCCCCTCCCTCATTGTGAGG - Intergenic
1148040909 17:44706359-44706381 ACATGCCCAGCCTGTGTGTGTGG + Intergenic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1148986615 17:51628088-51628110 ACAGCCCTAGCCCCTTCTTGGGG - Intergenic
1149526221 17:57357941-57357963 ACAGCCCCATCTCCTTTCTGAGG + Intronic
1151157235 17:72133812-72133834 ACACCTCCAGCCTCTTTCTGTGG + Intergenic
1151215216 17:72572348-72572370 ACAGTCCCAGCCTCTTCCTCTGG + Intergenic
1152906575 17:82973838-82973860 GCAGCCCCAGCGCCATTGTGGGG - Intronic
1154356726 18:13627348-13627370 ACAGCCCCAGCCTCAGGGTGTGG - Intronic
1157238922 18:45991093-45991115 ACAGCTCCCACCTCATTGTGGGG + Intronic
1158496179 18:57956963-57956985 CCAGCCCCTGCCTCTTTGCCTGG - Intergenic
1158936787 18:62372045-62372067 CCTGTCCCAGCATCTTTGTGAGG + Intronic
1160233721 18:77068885-77068907 ACACTCTCAGCCTCTTTGGGAGG + Intronic
1161089593 19:2353241-2353263 GCAGCCCCAACATCTTGGTGTGG - Exonic
1161678379 19:5666239-5666261 ACACCCACAGCCTATTTCTGTGG - Intronic
1161801226 19:6417683-6417705 GCACCCCCACCCTCTTTGGGAGG - Intronic
1162404222 19:10463831-10463853 ACAGCTCCAGCGGCTTGGTGGGG - Exonic
1163003604 19:14383974-14383996 ACAGCCCCTGCCTCCTAGAGTGG + Intronic
1163541150 19:17911364-17911386 TCAGCCCCACCCTCTTTCTCTGG - Intergenic
1164501002 19:28820321-28820343 CCAGCCTCAGCCTCCCTGTGAGG - Intergenic
1164728434 19:30483075-30483097 CCAGCCCCACCCTCACTGTGAGG + Intronic
1165711325 19:38012845-38012867 GCAGGTCCAGCCTCCTTGTGAGG - Intronic
1167321591 19:48800002-48800024 CCGGCACCAGCCTCTATGTGCGG - Exonic
1167390783 19:49193606-49193628 TCAGCCCCAGCCTCTCTGGGGGG - Intronic
1167933847 19:52890579-52890601 CCACACCCAGCCTCTGTGTGGGG - Intronic
1168400569 19:56083920-56083942 CCACCCACAGCCTCTTTGAGTGG + Intergenic
926223722 2:10952935-10952957 ACATCCACAGCCACATTGTGAGG - Intergenic
927054061 2:19353989-19354011 ACATTCCCACCCTCTTTGTGAGG - Intronic
928282917 2:29964467-29964489 CCAGCAGCAGCCCCTTTGTGGGG + Intergenic
928707107 2:33961871-33961893 ACAGCCTCTGCATATTTGTGTGG + Intergenic
929570379 2:43019120-43019142 CCAGCCTCAGCCTGTTTTTGTGG + Intergenic
930704578 2:54491699-54491721 TCTGCCTCAGCCTCTTGGTGTGG + Intronic
931679012 2:64727632-64727654 ACAGCCACAACCACCTTGTGAGG - Intronic
931756515 2:65379426-65379448 ATGGCCCCAGTCTCTTTGTGAGG - Intronic
932910449 2:75800728-75800750 TCTGCCCCAGCCTCTTGGTCTGG - Intergenic
933708679 2:85309420-85309442 ACAGGCCCAGCCTCTTTCCCTGG + Exonic
934039444 2:88115825-88115847 ACAGACCCAGCACCTTTCTGGGG + Intergenic
935667720 2:105526532-105526554 ACAGCCACTGGCTCTGTGTGAGG - Intergenic
936522120 2:113217992-113218014 ACAGCCAGAGCCTCCGTGTGGGG + Exonic
937307358 2:120880594-120880616 ACAGGCTCAGCCTCTTGGTGGGG - Intronic
937983816 2:127629688-127629710 GCAGCCCCTGCTTCTTTGTGAGG - Exonic
941066258 2:160906319-160906341 ACAGCATCAGCCTCATTGAGAGG - Intergenic
943330218 2:186550060-186550082 ACAGTCCCAGCTGCTTTGGGAGG - Intergenic
944730992 2:202517430-202517452 CCAGCCTCAGCCTCTATGTAGGG + Intronic
945920982 2:215754265-215754287 GCACCCCCTGCATCTTTGTGTGG + Intergenic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
948572727 2:238927619-238927641 GGAGCCCCAGGCTCTGTGTGGGG + Intergenic
948967991 2:241399598-241399620 CCACACCCAGCCTCTTTGTTGGG + Intronic
1168938477 20:1688492-1688514 CCTGCCCCAGCCTCACTGTGGGG - Intergenic
1168952789 20:1813932-1813954 ACAGCCCCTGGCTCTGAGTGGGG + Intergenic
1170231497 20:14051828-14051850 AAAGGCCCATCCTTTTTGTGAGG + Intronic
1170357782 20:15510890-15510912 AAAGCCCCAACCTTTTAGTGAGG + Intronic
1170567739 20:17616311-17616333 ACAGGCCCTGCCTCTTGGTGAGG + Intronic
1171248111 20:23629526-23629548 ACAGGACCACCTTCTTTGTGAGG - Intronic
1171460031 20:25292956-25292978 CCAGCCCCAGCCCATTTCTGTGG - Intronic
1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG + Intronic
1172898520 20:38317194-38317216 CCAGCCCCAATCTCTTAGTGAGG + Intronic
1173993486 20:47320420-47320442 ACAGCCGCAGCATCTTTACGTGG - Intronic
1174528309 20:51191178-51191200 ACTGTCACAGCCCCTTTGTGAGG + Intergenic
1175471770 20:59235145-59235167 ACAGCCCCAGACTCATCATGAGG - Intronic
1176227156 20:64007291-64007313 ACAGCCCCAGGCTGGCTGTGAGG - Intronic
1176387544 21:6146266-6146288 GCAGCCCCAGCCTCTGTGTGGGG - Intergenic
1176595077 21:8685902-8685924 CCTGCCTCAGCCTCTTTGAGTGG - Intergenic
1178722311 21:35020931-35020953 GAAGCCCCAGATTCTTTGTGGGG - Intronic
1179485830 21:41710302-41710324 ACAGTCACAGACTATTTGTGCGG - Intergenic
1179735928 21:43391982-43392004 GCAGCCCCAGCCTCTGTGTGGGG + Intergenic
1179960129 21:44763524-44763546 ATGGCCCCAGCCTCTGTGCGGGG - Intergenic
1181901926 22:26163218-26163240 ACAGACACAGCCTCTGTGTCAGG - Intergenic
1182796424 22:32994505-32994527 GCAGGCCCTGCCTGTTTGTGTGG - Intronic
1182826697 22:33271689-33271711 CCAGCCCCAGCTTATGTGTGGGG - Intronic
1184277389 22:43417814-43417836 ATAGCCCCAGCCTCTCTGATGGG - Intronic
1184375196 22:44107616-44107638 CCACCCCCAGCCTCTGGGTGGGG + Intronic
1185338949 22:50283165-50283187 GCAGCCCAAGCCTCTCAGTGTGG - Exonic
949350391 3:3119643-3119665 ACTGCCCCAGCCTCTTGCTTGGG + Intronic
949359986 3:3221481-3221503 TCAGCCCCAGCCTCAGTCTGTGG - Intergenic
952947132 3:38485960-38485982 TAAACCCCAGCCTCTTTGTTTGG + Exonic
954221734 3:49158971-49158993 ACTGCCCAAGCCTCTTTCTTGGG - Intergenic
954364097 3:50137270-50137292 ACAGACCCAGCCTCCTTCTTTGG + Intergenic
954493350 3:50929318-50929340 ACAGCCCCAGTGTCACTGTGGGG - Intronic
954764577 3:52902640-52902662 CCAGTCCCAGCAGCTTTGTGAGG + Intergenic
959699215 3:109282538-109282560 ACAGCACCAATCCCTTTGTGGGG + Intergenic
962400708 3:135056719-135056741 AAACCCCAAGCATCTTTGTGTGG - Intronic
966194344 3:177298321-177298343 ACACCTCCTGCATCTTTGTGTGG - Intergenic
966866001 3:184259641-184259663 CCAGCCTCAGCCTCTTTCTAAGG - Exonic
968077150 3:195822269-195822291 CCTGGCCCAGCCACTTTGTGAGG - Intergenic
968552931 4:1233331-1233353 ACAGCCCCAGCACCTCTGTCTGG + Intronic
968648254 4:1750372-1750394 ACATCCCCAGTCTCTAAGTGTGG - Intergenic
968808883 4:2791385-2791407 ACAGCCCCAGCGCCGGTGTGAGG + Intergenic
970454120 4:16205085-16205107 AAAACGCCAGCCTCTTTCTGTGG + Intronic
977475811 4:97507804-97507826 ACATGCCCTGACTCTTTGTGGGG - Intronic
977855545 4:101886280-101886302 ACAGGCACAGCCCCTTTTTGAGG + Intronic
982122757 4:152158318-152158340 AAAACCCCAGCCTCATTATGGGG - Intergenic
983537293 4:168871737-168871759 TCAGTCCCAGCCTCTTTTTGGGG - Intronic
986318578 5:6609054-6609076 AGAGCTCCAGCCTTTTTCTGGGG - Intronic
988456495 5:31391738-31391760 TCAGCCCAAGCATCTTTGTTGGG + Intergenic
991508903 5:67354873-67354895 ACAGCCCCAGTCTTAGTGTGTGG + Intergenic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
993023953 5:82625183-82625205 ACAGCCACAACCTCCTTATGTGG - Intergenic
993095582 5:83474484-83474506 CCAGACCCAGCCCCTTTGGGCGG - Intronic
995512198 5:112921323-112921345 ACAGGCCCAGCCTCGCGGTGTGG - Intronic
995752911 5:115472292-115472314 AAATCCACAACCTCTTTGTGAGG - Intergenic
995843434 5:116467419-116467441 GCAACCCCATCCTCTATGTGAGG - Intronic
997411860 5:133696770-133696792 ACACCCACAGCCTCTGTGTTAGG + Intergenic
997527151 5:134560738-134560760 CCAGCTCCGGCCTCTCTGTGAGG - Exonic
999705756 5:154271133-154271155 ACAGCCCCAGCCTCATTTACAGG - Intronic
1000253082 5:159513642-159513664 ACATCCCCACCCTCCTTGTCTGG + Intergenic
1003053473 6:2799604-2799626 ACAGCCTCTGCCCCTTAGTGAGG - Intergenic
1004355648 6:14927981-14928003 ACAGCCACAGCCTCATGGTCAGG - Intergenic
1005835814 6:29708657-29708679 ACAGCCACAGCCTCTGGGTAGGG + Intergenic
1005910226 6:30303026-30303048 TCAGGCCCAGCCACTCTGTGGGG - Intergenic
1006451058 6:34105951-34105973 ACAGCTCCAGCATCTCTGTCTGG + Intronic
1006887848 6:37397277-37397299 ATAGCCACAGCTGCTTTGTGAGG - Intergenic
1007095874 6:39212672-39212694 ACACCCCCACCACCTTTGTGTGG + Intronic
1011085742 6:83538385-83538407 CCAGGCCCTGCCGCTTTGTGGGG + Intergenic
1013073294 6:106748652-106748674 ACTGCACCAGCCTCTTAATGGGG + Intergenic
1014541761 6:122684464-122684486 AAAGGCCCAGCCTCTGTTTGGGG - Intronic
1014769377 6:125444310-125444332 CCAGCCACTGCTTCTTTGTGAGG + Intergenic
1014837685 6:126178348-126178370 ACAGCCTCAGCCTCAGTGTCTGG - Intergenic
1017629591 6:156383461-156383483 CCAGCCCCACCCACTTTCTGTGG - Intergenic
1019270431 7:144073-144095 GCAGCGCCAGTCTCTGTGTGTGG - Intergenic
1023498017 7:40818500-40818522 ACAGCCACTGCCCCTTTTTGAGG - Intronic
1026446207 7:70487054-70487076 ACAGCCCCTCCCTATTTGGGAGG + Intronic
1026848622 7:73711470-73711492 ACAGCCCCAGGCACTCGGTGGGG - Intronic
1029447234 7:100620584-100620606 ACAGCCCCTTCCCCTTTCTGGGG - Exonic
1032512988 7:132486775-132486797 GAAGCCCCAGCCTCTTGGTGGGG + Intronic
1035660453 8:1343755-1343777 ACTGCCCCCGCCTCTTGGAGAGG - Intergenic
1035739493 8:1915477-1915499 CCAGGCCCAGCCTCTGTCTGGGG + Intronic
1036039863 8:5064604-5064626 ACAGGCCGACCCTCTTTGTTAGG + Intergenic
1042196723 8:66237535-66237557 ACAGGCACAGGCTCTCTGTGAGG + Intergenic
1042805269 8:72764344-72764366 ACATCTCCAACCTCTTTGTGAGG - Intronic
1045598598 8:103686915-103686937 CCATGCCCAGCTTCTTTGTGTGG + Intronic
1047462185 8:125077246-125077268 CCAGCCCCAGCCGCTTCCTGTGG - Intronic
1049353199 8:142175172-142175194 ACAGCCCCAGCCTGGTGCTGGGG + Intergenic
1049527685 8:143136625-143136647 TCAGCCACAGCCTCTCTGAGGGG - Intergenic
1049625990 8:143621538-143621560 ACAATCCCAGCATCTTTGGGAGG + Intergenic
1050325190 9:4491155-4491177 ACACCCCCAGCCTCGCTGCGCGG + Intronic
1051229710 9:14943220-14943242 ACAGCACCAAGCTATTTGTGAGG + Intergenic
1059353894 9:113685112-113685134 ACAGCCCCAGCCTCCTTTGCAGG - Intergenic
1059467512 9:114478448-114478470 ACAGAACCAGCCTCTTCTTGCGG + Intronic
1059549805 9:115217433-115217455 TCAGCCCCAGCTTCAGTGTGGGG + Intronic
1060528305 9:124332902-124332924 ACCGCCCCCTCCTCTTGGTGGGG - Intronic
1060831679 9:126721570-126721592 TCAGCCCCAGCATCTGTATGAGG - Intergenic
1061239085 9:129358777-129358799 ACACCCACAGCCCCTGTGTGGGG - Intergenic
1061473213 9:130843939-130843961 ACAACCCCAGCCATTTTTTGAGG + Intronic
1061580199 9:131531481-131531503 GCAGCCCCAGCCTCGGGGTGCGG - Intergenic
1061712176 9:132495894-132495916 ACAGACCCAGTGTCTTGGTGAGG - Intronic
1061787947 9:133042098-133042120 ACAGCTCCAGCCTCTTGGTGGGG - Exonic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062120426 9:134831145-134831167 CCAGCCCCAGCCTCCCTGGGTGG + Intronic
1062322385 9:135996760-135996782 ACAGCACCAGCCTCTGTGTGGGG + Intergenic
1186024549 X:5295028-5295050 GCAGCCCCAGCTACTTTGGGGGG + Intergenic
1187277975 X:17832806-17832828 ACATCCCCAGCATAATTGTGGGG - Intronic
1189987478 X:46566801-46566823 CCAGCCCCAGCCTCTCCTTGGGG - Intergenic
1198638718 X:138730900-138730922 ACAGCCACACCATCTTTGTTAGG - Intronic