ID: 1144264566

View in Genome Browser
Species Human (GRCh38)
Location 17:13555522-13555544
Sequence CAAGATGCTTCCACTCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144264566 Original CRISPR CAAGATGCTTCCACTCTAAG GGG (reversed) Intronic
902994073 1:20210292-20210314 CTAGATGCCTCCACTCAGAGTGG - Intergenic
903367204 1:22812335-22812357 CATGAGGCTTCCACTCGGAGTGG + Intronic
903425092 1:23247551-23247573 CAACAAGCTTGCACTCTAAGTGG - Intergenic
903740474 1:25555860-25555882 CAAGGAGCTTCCACTCTAGTTGG + Intronic
905131188 1:35759505-35759527 TAAGATGCTTTTACTCTAATGGG - Intronic
906090642 1:43176643-43176665 CACAGTGCTTCCATTCTAAGAGG + Intronic
907236369 1:53052873-53052895 CAAGGTGCTTACATTCTAATGGG + Intergenic
908470002 1:64434425-64434447 CAGGCTGCTTCCACTCATAGTGG - Intergenic
908643543 1:66251733-66251755 CAAAATGCTCCCACACTAACTGG - Intronic
909607942 1:77525463-77525485 CAGGAAGCTTCCACTCACAGCGG + Intronic
910702618 1:90092566-90092588 CAATATGCTCACACTATAAGAGG - Intergenic
911714061 1:101110326-101110348 CAAGAAGCTTCCAGTCCAAAAGG - Intergenic
911719931 1:101179937-101179959 CAAGAAGCTTACAGTCTAATGGG + Intergenic
912393746 1:109323403-109323425 CAAGTTCCTTCCAAACTAAGAGG + Intronic
912710115 1:111944122-111944144 CAAGTGGCTGCCTCTCTAAGGGG + Intronic
915015243 1:152726885-152726907 CAAGTTGCTTCCATCCTAACAGG - Intergenic
917603406 1:176600811-176600833 GAAGGTGCTTCCACTGTGAGTGG - Intronic
919941988 1:202294249-202294271 CAAGAAGCTTTCATTCTAATTGG + Intronic
921180832 1:212630108-212630130 CAGGAGGCTTCTACTCTCAGAGG - Intergenic
922339497 1:224644045-224644067 CATGAAGCTTTCAGTCTAAGAGG - Intronic
923370837 1:233310789-233310811 CAGGCTGCTTCCACTCATAGTGG + Intergenic
924727803 1:246686390-246686412 CAAAATGCTTCCTCTTTAGGAGG - Intergenic
1063770256 10:9189379-9189401 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1065086215 10:22180075-22180097 CAGGCTGCTTCCACTCGTAGTGG - Intergenic
1065507810 10:26446916-26446938 CAAGAAGCTTCCAGTCTAGTGGG + Intronic
1065675945 10:28174485-28174507 CAGGACGCTTCCACTTTCAGTGG - Intronic
1067249020 10:44571744-44571766 CAAGATGCTGCGACTGAAAGAGG - Intergenic
1067905165 10:50283016-50283038 CATGGTGCTTCCATTCTAACTGG + Intergenic
1068100586 10:52547677-52547699 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1068345244 10:55769437-55769459 CAGCATTCTTCCACTCAAAGAGG + Intergenic
1070810274 10:79294064-79294086 CAAAATGCTTCCAGTCTATAAGG + Intronic
1070861319 10:79665496-79665518 CAGCATTCTTCCACTCAAAGAGG - Intergenic
1070875930 10:79810103-79810125 CAGCATTCTTCCACTCAAAGAGG + Intergenic
1071642863 10:87332236-87332258 CAGCATTCTTCCACTCAAAGAGG + Intergenic
1072231993 10:93421712-93421734 CAAGAAGCTTCCACTCATGGGGG - Intronic
1072477108 10:95772998-95773020 CAGGCTGCTTCCACTCTTGGAGG + Intronic
1073383805 10:103104706-103104728 TTAGATGCTTCAATTCTAAGGGG + Intronic
1073732831 10:106310872-106310894 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1074236619 10:111591076-111591098 GAAGCTGCTTTCACTGTAAGTGG + Intergenic
1074439395 10:113461601-113461623 GGAGATGCTTCCATTCTCAGGGG - Intergenic
1075594331 10:123717074-123717096 CAAGAAGCTTACAGTCTAAGTGG - Intronic
1076838510 10:133033123-133033145 CAGGAAGCTTCCACTCTTGGTGG - Intergenic
1080209109 11:29765046-29765068 CATGCTGCTTCCACTCAAGGCGG - Intergenic
1080720676 11:34845359-34845381 CAGGATGCTTCCATTCATAGTGG - Intergenic
1081419837 11:42862954-42862976 CAAGGTTTTTCCACTCTGAGTGG + Intergenic
1081953984 11:47073253-47073275 CAAGATGCTTACAATCTAGCTGG + Intronic
1083180909 11:60984585-60984607 CAAGAAGCTTCTATTCTAATAGG + Intronic
1083609533 11:63998469-63998491 CCAGATGCTTTCACTGAAAGGGG - Intronic
1085321038 11:75574164-75574186 CATGGAGCTTCCATTCTAAGAGG - Intergenic
1087645393 11:100802996-100803018 CATGAAGCTTGCATTCTAAGGGG + Intronic
1087686823 11:101274471-101274493 CCATAAGCTTCCATTCTAAGAGG - Intergenic
1087867115 11:103243831-103243853 CAAGATCTTTTCACTATAAGAGG - Intronic
1088025770 11:105180403-105180425 CAAGATCCTTCTAATCAAAGAGG + Intergenic
1088188538 11:107200578-107200600 CAGGAGGCTTACACTCTTAGAGG + Intergenic
1088386798 11:109267530-109267552 CAAGATGCTGCCACTCCTTGAGG - Intergenic
1088569513 11:111208561-111208583 AAAGATGATTCCAATCCAAGTGG - Intergenic
1089883613 11:121798209-121798231 CAGGAAGCTTCAACACTAAGAGG - Intergenic
1090131639 11:124148322-124148344 CAAGATTCTTCCACTCAAACAGG + Intergenic
1090534540 11:127626182-127626204 GAAGATGCTTCAACCCCAAGAGG + Intergenic
1091458609 12:627258-627280 CAAGAAGCTTCAATTCTAAAAGG - Intronic
1093256660 12:16876066-16876088 CAAGGTCCTTCCATTCTAATGGG - Intergenic
1093334423 12:17884650-17884672 CAATAGGCTTAAACTCTAAGTGG + Intergenic
1093447164 12:19273557-19273579 CAAGATCATGCCACTCTAGGAGG - Intronic
1094459323 12:30677151-30677173 CACGAAGCTTACACTCTAACTGG + Intronic
1096017090 12:48286485-48286507 CAGGATGTTTCCTCTCTATGTGG - Intergenic
1097815721 12:64071497-64071519 CAAGTTGCTTCCACCGTAGGTGG + Intronic
1099624804 12:85057458-85057480 CTATATGCTTCCATTCTTAGAGG - Intronic
1101769530 12:107736203-107736225 CATGAAGCTTACATTCTAAGTGG + Intronic
1102482471 12:113233218-113233240 CAAGACGCTGCCGCTCTAAATGG + Intronic
1102630335 12:114272870-114272892 CAAGATGCATCTCTTCTAAGTGG + Intergenic
1106130706 13:26937100-26937122 CAGGATGCTTCCACTCATGGTGG - Intergenic
1106360904 13:29029694-29029716 CAGGCTGCTTCCACTCAAGGGGG + Intronic
1106828942 13:33557146-33557168 CAATATTCTTTCAATCTAAGGGG - Intergenic
1109978156 13:69870194-69870216 CAAGATGCTGCCACTCGTAGTGG + Intronic
1110002994 13:70229419-70229441 CAAGCTGCTTCCACTCATGGTGG - Intergenic
1111148999 13:84223462-84223484 CAATATGTTTTGACTCTAAGAGG - Intergenic
1112288256 13:98123059-98123081 CAGGCTGCTTCCACTCACAGTGG - Intergenic
1113429898 13:110240700-110240722 CAAGCCGCTTCCACTCCGAGTGG - Intronic
1115137917 14:30133191-30133213 CAAGCTGCTTCCACTCATAGTGG - Intronic
1115436710 14:33383198-33383220 CAAGTTGCTTACAATCTAACAGG - Intronic
1118035837 14:61864981-61865003 CAACAGGCTGCCACTGTAAGAGG - Intergenic
1121029303 14:90644564-90644586 CAAGATGATTTTGCTCTAAGTGG + Intronic
1122348953 14:101076956-101076978 CAAGATGCTTCCTGGCCAAGAGG + Intergenic
1123219618 14:106843770-106843792 TATGATGCTTCCACTTTAGGAGG + Intergenic
1124117088 15:26854718-26854740 CAGGCTGCTTCCACTCAAGGTGG - Intronic
1124412210 15:29445825-29445847 TCAGATGCTTCCACTCTAGATGG - Intronic
1125093989 15:35829871-35829893 CAGGGTGCTTCCACTCTTGGTGG + Intergenic
1125957318 15:43799436-43799458 CCAGCTGCTGCCACTCTAGGTGG - Exonic
1127429740 15:58892278-58892300 CAAGATGTTTCCATTTTTAGTGG - Intronic
1132993193 16:2807986-2808008 CAAGAAGCTTCCACTCATGGCGG + Intergenic
1135551092 16:23398848-23398870 GAAGATGTTTCCACTCCAAATGG - Intronic
1136276420 16:29181659-29181681 CAACATGCTCACAGTCTAAGGGG - Intergenic
1137272681 16:46912669-46912691 CAGGAAGCTTCCAGTCAAAGCGG + Intronic
1139688714 16:68624865-68624887 CAAGAGGCAAACACTCTAAGAGG + Intergenic
1141718687 16:85742461-85742483 CAGGCTGCTTCCACTCAAGGCGG - Intronic
1141727982 16:85802380-85802402 CAAAAGGCTTACACTCTAAGAGG - Intronic
1142080802 16:88147719-88147741 CAACATGCTCACAGTCTAAGGGG - Intergenic
1144216166 17:13057519-13057541 CAGGAAGCTTCCAATCAAAGGGG + Intergenic
1144264566 17:13555522-13555544 CAAGATGCTTCCACTCTAAGGGG - Intronic
1147446459 17:40477990-40478012 CAGGGAGCTTCCACTCTAATGGG - Intronic
1147939035 17:44032662-44032684 CAATATGCTTTCAATCTAGGTGG + Intergenic
1150632135 17:66887248-66887270 CAACACCCTTCCACTCTGAGGGG + Intergenic
1150816437 17:68395775-68395797 CAAGAAGCTTCCATTCTAGAGGG - Intronic
1152496197 17:80673969-80673991 CAAGATGATGACACTCTCAGTGG - Intronic
1153062878 18:1012402-1012424 CAAGATGCTGCCACTCAGAAAGG + Intergenic
1162449756 19:10747714-10747736 CATGAGGCTGCCACTCTAATAGG + Intronic
1163964748 19:20734855-20734877 CACGTTTTTTCCACTCTAAGTGG - Intronic
1166367755 19:42285870-42285892 GAAGATGCTTCCTCACCAAGAGG - Intronic
927316850 2:21693267-21693289 CCAGATGGTTCAAATCTAAGAGG - Intergenic
927757307 2:25719301-25719323 CAAGATGCTTTAATTCAAAGAGG - Intergenic
930540367 2:52698376-52698398 CAGAATGCTTCCGCTCAAAGAGG + Intergenic
932072176 2:68631695-68631717 CAAGGTGCTTCCATACAAAGTGG + Intergenic
935822633 2:106909400-106909422 CAAGCTGCTTCCACTCATGGCGG - Intergenic
935870768 2:107446664-107446686 CAGGCTGCTTCCACTCATAGTGG + Intergenic
937941614 2:127290679-127290701 CAAGATGCTTACATTCTATTTGG - Intronic
938159441 2:128972609-128972631 CACGATGCTTAGGCTCTAAGAGG - Intergenic
939518751 2:143203064-143203086 CAATATGCTTCCAGTCTTATTGG + Intronic
939779737 2:146430962-146430984 CAAGAAGCTTTTACTCAAAGAGG - Intergenic
941589689 2:167404103-167404125 CAAGCTGCTTCCACTCATGGTGG + Intergenic
941914426 2:170800653-170800675 CAAAATGCTTCCCCTCAAATCGG - Intergenic
942231238 2:173862550-173862572 CAAGAAGCTTATACTCTAATGGG + Intergenic
942954895 2:181762631-181762653 CAAGATGGATCTACTCCAAGTGG + Intergenic
943461898 2:188179611-188179633 CTATATGCTTCCTCTCTTAGAGG + Intergenic
945789520 2:214287480-214287502 CAAGAAAATTCCACTCTTAGAGG - Intronic
948264379 2:236626523-236626545 AAGGATGCTTCCACACTGAGAGG - Intergenic
948268758 2:236657737-236657759 CAAGCTTCTTCCACTCTCTGTGG + Intergenic
1170770895 20:19331752-19331774 CATGAAGCTTCCATTCTAGGGGG + Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1170946874 20:20899366-20899388 CAAAATGCTTTTACTCTGAGTGG + Intergenic
1173048870 20:39539798-39539820 CAAGCTGCTTCCACTCAAGGTGG - Intergenic
1173823093 20:46031042-46031064 TCAGATGCCTCCACTCTGAGAGG + Intronic
1174311229 20:49656229-49656251 CAGGCTGCTTCCACTCTTGGTGG - Intronic
1174487881 20:50872604-50872626 CAAGATGCTAGCACCCCAAGGGG + Intronic
1174497659 20:50959648-50959670 CAACAAGCTGCCACTGTAAGAGG - Exonic
1177881089 21:26695708-26695730 CAAGTTTCTTCCCATCTAAGGGG + Intergenic
1178349254 21:31860573-31860595 CAGGCTGCTTCCACTCAAGGTGG + Intergenic
1179184341 21:39072913-39072935 TAAGATGCTGCCACTATACGTGG - Intergenic
1179420531 21:41232701-41232723 CAGGAAGCTTCCACTCAAGGTGG - Intronic
1180126731 21:45796856-45796878 AATCATGCTTCCATTCTAAGAGG - Intronic
1182861142 22:33560453-33560475 ACAGATGCCTCCCCTCTAAGAGG - Intronic
1183001131 22:34860092-34860114 CATGGTGCTTCCATTTTAAGTGG - Intergenic
1184709272 22:46238867-46238889 CAAGATGCTTCCAGTTACAGCGG + Exonic
950452697 3:13074060-13074082 CATGATGTTTACAGTCTAAGGGG + Intergenic
952122102 3:30257732-30257754 CATGCTGCTTCCACTCTTGGTGG + Intergenic
953429640 3:42828509-42828531 CAAGATGTTGCCACTTTTAGGGG - Intronic
955509118 3:59661809-59661831 CAAGGTGCTTACACTCTGAAGGG + Intergenic
955964050 3:64369944-64369966 CATGGAGCTTCCATTCTAAGAGG + Intronic
956664844 3:71632424-71632446 CAAGAAGCTTATACTCTAAAGGG + Intergenic
957579762 3:82055933-82055955 CAAGGTGGTTCCTCTCTATGTGG - Intergenic
958720141 3:97833895-97833917 CAAGCTGCTTCCACTCATGGTGG + Intronic
958945585 3:100358307-100358329 CAATGTTCTTCCACTCCAAGTGG - Intergenic
958967931 3:100579711-100579733 CAAGCTGCTTCCACTCACAGCGG - Intergenic
959112195 3:102135010-102135032 CAAGAAGCTTACATTCTAATGGG - Intronic
961400845 3:126641379-126641401 CAAGCTGCTTCCAGTCTTAAAGG + Intronic
965304577 3:167047974-167047996 CAAGATGCTTAAAATCTAATAGG - Intergenic
966237256 3:177715840-177715862 CAAAATGTATTCACTCTAAGTGG + Intergenic
966644419 3:182227494-182227516 CATGTTGCTTCCAATCTAAAGGG + Intergenic
970293179 4:14599290-14599312 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
970935421 4:21564748-21564770 CAGGATGCTTCCACTCATGGTGG + Intronic
972183287 4:36495986-36496008 CAAAATGCTTCATTTCTAAGTGG - Intergenic
972451551 4:39204791-39204813 AAAGACTCTTCCACTCTAAGAGG - Intronic
972735010 4:41831969-41831991 CTATATGCTCCCACTCTAACAGG - Intergenic
973036366 4:45412410-45412432 CAGGAAGCTTCCACTCTTGGTGG - Intergenic
977915630 4:102589428-102589450 AAATATGCTTCCACTAGAAGGGG - Intronic
979865949 4:125754168-125754190 CAGTATACTTCCAGTCTAAGTGG + Intergenic
980904677 4:138936841-138936863 CAGGCTGCTTCCACTCATAGCGG + Intergenic
981038246 4:140194798-140194820 CAAGAAGCTTCCAGTCTGATGGG - Intergenic
982047429 4:151462756-151462778 CAAAATGCTCTCACTCTGAGAGG - Intronic
984104609 4:175529488-175529510 CAAGATGCTCATACTCTAGGGGG - Intergenic
984244114 4:177254100-177254122 CATGAAGCCTCCACTCTTAGAGG + Intergenic
985022076 4:185702261-185702283 CATGATGCTTCCACTCCTGGTGG + Intronic
985732930 5:1560618-1560640 CTAAAGGCTTACACTCTAAGGGG - Intergenic
985879691 5:2628830-2628852 CATGCTGCTTCCTCTCTCAGTGG + Intergenic
988447413 5:31303237-31303259 CATGATACTTCCAGTCTAGGGGG + Intronic
990941020 5:61203251-61203273 CAAGAAGCTTCCACTCACGGAGG - Intergenic
991608880 5:68430165-68430187 CAAGATGATGCCACTCTAGCGGG - Intergenic
992000383 5:72430429-72430451 CAAGCTGCTTCCACTCATGGTGG - Intergenic
995199269 5:109409382-109409404 TAAGATGGTTCCGCTCTACGCGG + Intronic
995516594 5:112960399-112960421 CAACATGCTTTCATTTTAAGGGG - Intergenic
997014268 5:129912850-129912872 CAAGATGCCTCAATCCTAAGTGG - Intronic
997357883 5:133276133-133276155 CACAATGTTTCCCCTCTAAGTGG + Intronic
999394616 5:151219343-151219365 CAAGATGCTGTCTCTCTAAGGGG + Intronic
1001145437 5:169179946-169179968 CAAGAAGCTTACAATCTATGGGG + Intronic
1001326899 5:170734988-170735010 CAGGCTGCTTCCACTCACAGTGG - Intronic
1001327518 5:170739884-170739906 CAGGCTGCTTCCACTCATAGTGG - Intergenic
1002182244 5:177436604-177436626 CAGGATGCTTCCAGTGCAAGTGG + Intronic
1002511634 5:179723455-179723477 CAAGATGATTTCACTCTCATAGG - Intronic
1009314747 6:62204053-62204075 CAAGCTGCTTCCACTCATGGTGG - Intronic
1011622299 6:89254310-89254332 TAAGAAGCTTACACTCTAATGGG - Intergenic
1013642647 6:112101905-112101927 CAAGATCTTTCCACTTTAACTGG - Exonic
1014304124 6:119718990-119719012 CAAAATGCTTCCCCTTAAAGTGG + Intergenic
1014641078 6:123911329-123911351 CAGGAAGCTTCCACTCATAGTGG + Intronic
1015520898 6:134130275-134130297 CAAGTTGCTTCCACTCATGGTGG - Intergenic
1017959270 6:159207555-159207577 AAAGCTGCTTCCCCTCTCAGAGG - Intronic
1018067915 6:160136540-160136562 CTAGATGCTTTCCCTCGAAGAGG + Exonic
1018464469 6:164030981-164031003 CAAGGAGCTTACACTCTAACAGG + Intergenic
1018480654 6:164186253-164186275 CAACATGCACACACTCTAAGGGG - Intergenic
1022409609 7:30128804-30128826 CAGGCTGCTTCCACTCAAGGTGG + Intronic
1023926132 7:44671183-44671205 CAGGCTGCTTCCACTCCTAGTGG + Intronic
1027148539 7:75715875-75715897 CAAGAAGCTTTCACTCAAGGCGG + Intronic
1030716184 7:112810283-112810305 CAAGAAGCTTCCAGTCTAGTGGG - Intergenic
1031257142 7:119467474-119467496 CAAGATGCTGTCACTGTATGAGG + Intergenic
1031943782 7:127817129-127817151 CAAGTTGCTTGCAGTCTAACTGG + Intronic
1035030494 7:155854179-155854201 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1036387913 8:8297771-8297793 CAGGTTGCTTCCACTCTTGGTGG - Intergenic
1036661914 8:10714470-10714492 CAAGTTGCTTCCCCTCTCTGGGG - Intergenic
1036702959 8:11025341-11025363 TAATATGCTTCCTTTCTAAGAGG + Intronic
1039055784 8:33535246-33535268 CAAGATGTTTACAGTCTAATGGG - Intergenic
1041618384 8:59935113-59935135 TAAGATGCTTTAAGTCTAAGAGG + Intergenic
1042810447 8:72819936-72819958 CCAGATGCCTCCACTCTAGTTGG + Intronic
1043375149 8:79640640-79640662 CAAGATGCTTACAGTCTAATGGG - Intronic
1043421301 8:80101626-80101648 CAGGAAGCTTCCACTCATAGTGG + Intronic
1043553934 8:81407610-81407632 CAAGATGCTGCCAATCCAAGAGG - Intergenic
1045594851 8:103641815-103641837 CAAGTTGCTTCCACTCATGGTGG - Intronic
1047877079 8:129150297-129150319 CAAGATCCTTCCCCTCATAGGGG + Intergenic
1048516431 8:135115869-135115891 CAGGCTGCTTCCACTCTTGGTGG + Intergenic
1048845904 8:138603479-138603501 CAGGAGGCTCCCATTCTAAGGGG + Intronic
1050056666 9:1662353-1662375 CATGGTGTTTGCACTCTAAGAGG + Intergenic
1052092075 9:24340850-24340872 CAACATGCTTCCAAGATAAGAGG - Intergenic
1053189644 9:36052047-36052069 CAAGAAGCTTGCAGTCTAATAGG - Intronic
1054834468 9:69661858-69661880 CATGCTGCTTCCACTCATAGTGG - Intronic
1057704063 9:97385485-97385507 CAAGATGCCTCATCTCTAGGAGG + Intergenic
1058918798 9:109593670-109593692 CAAGCTGCTTCCACTCATGGAGG + Intergenic
1059962096 9:119575592-119575614 CAAGAAGCCTCCAGTCTAATGGG + Intergenic
1060447826 9:123707856-123707878 CTACATGCTTCCACAATAAGGGG + Intronic
1061708751 9:132473028-132473050 CAGGCTGCTTCCACTCACAGCGG + Intronic
1062558607 9:137129187-137129209 CCAGAGGCTTCCGCTCCAAGAGG + Intergenic
1187123450 X:16431207-16431229 CAGGATGCTTCCACTCATGGTGG - Intergenic
1188508906 X:30912509-30912531 CCATATGCCTCCACTCTAACAGG - Intronic
1189273855 X:39770728-39770750 CAGGATGCTTCCACTCTAGTGGG - Intergenic
1192030567 X:67508311-67508333 CTGGATGCTTCCACTCATAGTGG - Intergenic
1193393223 X:80954229-80954251 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1194483621 X:94458146-94458168 CAAGATGCTGCTACTCTTTGGGG + Intergenic
1195438638 X:104875374-104875396 CAAGATGCTTACAGTCTAGTGGG + Intronic
1195964166 X:110415096-110415118 CAAGATGCTTCCAGTTTAATGGG - Intronic
1197367682 X:125584087-125584109 CAAGGTGCTTCCACTCAGGGCGG - Intergenic
1198083399 X:133261081-133261103 CAAGATGCTTACAATCTTGGCGG - Intergenic
1200302008 X:154985772-154985794 CAAGATGCTTACACTCTAGCTGG + Intronic
1202110787 Y:21417008-21417030 CAAGATGATTCCAATGTAAATGG - Intergenic