ID: 1144265079

View in Genome Browser
Species Human (GRCh38)
Location 17:13561324-13561346
Sequence GAAAATCAGGAGCAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 611}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144265079 Original CRISPR GAAAATCAGGAGCAGAGGGA AGG (reversed) Intronic
900178805 1:1302468-1302490 CACAACCAGGAGCAAAGGGACGG + Intronic
900827377 1:4937652-4937674 GGAAATGAACAGCAGAGGGAAGG + Intergenic
900932828 1:5747616-5747638 GGAAGGGAGGAGCAGAGGGAGGG + Intergenic
900967657 1:5970152-5970174 GAAAAGCAGCAGCAGAGTGAAGG - Intronic
901124885 1:6922235-6922257 CAAAAGCAGGTGCAGAGGGAAGG + Intronic
901887801 1:12235693-12235715 GAAAACCAGGAGAATAGGAAAGG - Intronic
901959097 1:12810415-12810437 GTAAATGAGGAGGAGAGAGATGG - Intergenic
902163401 1:14550763-14550785 GATAAGCAGGAGTAGGGGGAAGG - Intergenic
902906812 1:19564277-19564299 GAAATTCAGGACCAGAGGCCTGG + Intergenic
903139963 1:21333405-21333427 TAAAATAAGTAGCAGAGAGATGG + Intronic
904414642 1:30351575-30351597 AAAAATCAGGGGCAGAGGGGAGG - Intergenic
905940084 1:41856294-41856316 GAAAAGAAGGAGCAGATGGGTGG + Intronic
906863905 1:49394706-49394728 GCAATGCAGGAGCAGAGGGAAGG - Intronic
906940761 1:50253153-50253175 GAAAATGAAGAGCAAGGGGAAGG - Intergenic
907535495 1:55151820-55151842 GAGTATCAAAAGCAGAGGGAAGG + Intronic
907572146 1:55493162-55493184 GGAAAGCAGGAGGAGGGGGAGGG - Intergenic
907921775 1:58920714-58920736 GAAACTGAGGAGCAAAGTGATGG + Intergenic
908025152 1:59942714-59942736 GATTAGCAGTAGCAGAGGGAGGG + Intergenic
908368697 1:63457091-63457113 GAAAAGGAGGAGGAGAGGAAAGG - Intronic
908571796 1:65419255-65419277 AAAAAGCAAGAGAAGAGGGACGG + Intergenic
908824129 1:68117081-68117103 GAAAAGCAGGGATAGAGGGAGGG - Intronic
909016837 1:70389073-70389095 GGAAAGCTGGAGGAGAGGGAAGG - Intergenic
910008765 1:82434173-82434195 GAAAATCAGGAGAAAGAGGAGGG + Intergenic
910159883 1:84261291-84261313 GAAAACAAAGAGCAGTGGGAAGG - Intergenic
910359858 1:86404805-86404827 GCAAAGAAGGAGCAGAGGAAAGG - Intergenic
911175163 1:94811178-94811200 GAAAATAAGGGGGAGAAGGAGGG - Intergenic
911864364 1:102997920-102997942 GAAAAGGAGGAGAAGATGGAAGG + Intronic
912027220 1:105191947-105191969 GAAAATTAGGAGCAAAGTCATGG - Intergenic
912537464 1:110385605-110385627 TAAAAGCAGGGGCTGAGGGAGGG - Intronic
913113212 1:115674252-115674274 GTACACCAGGAGAAGAGGGACGG - Intronic
913150413 1:116036464-116036486 TGAAATCTGAAGCAGAGGGAAGG + Intronic
913456484 1:119036891-119036913 GAGCAGCAGGAGCACAGGGAGGG - Intronic
914385174 1:147162204-147162226 TAAAATCAGGATCAGAGCTATGG - Intronic
915003441 1:152614399-152614421 GACCTTCAGGAGCTGAGGGAGGG - Intergenic
915292951 1:154898547-154898569 GGAATGGAGGAGCAGAGGGAGGG - Intergenic
915516537 1:156415998-156416020 GAGAATGAGGAGCAGAGTTATGG - Intronic
916570785 1:166025484-166025506 GAAAAGAAGGAAAAGAGGGAGGG - Intergenic
916860740 1:168802182-168802204 TAAAAACAGGAGCACAGAGAGGG - Intergenic
916958802 1:169868217-169868239 GAAAAACCAGAGCAAAGGGAAGG - Intronic
917488878 1:175480261-175480283 GAATGTGATGAGCAGAGGGAGGG + Intronic
917493461 1:175518440-175518462 GAAAATCAGGAGCCTTGTGATGG - Intronic
917735189 1:177913846-177913868 GAAAATCAGGACTAGATGCAGGG + Intergenic
918348485 1:183628746-183628768 GAAAATCATGAGCAAATGTATGG + Intronic
918802510 1:188989696-188989718 GAAAATCAGTACAGGAGGGAGGG + Intergenic
919620668 1:199861272-199861294 GAGTATCAGGAGTAGAGGGAAGG - Intergenic
919746363 1:201011425-201011447 GACAGTCAGGAGCAGAGCCAGGG + Intronic
920311612 1:205052080-205052102 GAAACTTAAGAGCAGTGGGAGGG - Intronic
921297164 1:213715016-213715038 GAACAGCAGAACCAGAGGGATGG + Intergenic
921584366 1:216930204-216930226 GAATATCTGAAGCAGAAGGAAGG - Intronic
921601661 1:217112588-217112610 TAAATTCAGGAAGAGAGGGATGG + Intronic
922097032 1:222451256-222451278 GAGAAACAGGAGCAGAGAAATGG + Intergenic
922676771 1:227558430-227558452 GAAAATGGGGAGCAGAGTCAGGG - Intergenic
922677421 1:227561359-227561381 GAAAAGGAGGAGCAGAGTCAGGG - Intergenic
923034016 1:230271689-230271711 GAAACCCAGGAGCAGCTGGACGG + Intronic
923202644 1:231726791-231726813 GAATATCAGGAAAAGAGAGACGG + Intronic
923394220 1:233544629-233544651 GTGAATCAGGAGCAGAGGGAAGG - Intergenic
924145358 1:241068965-241068987 GAAAAGCAGGAGCAAGAGGAGGG - Intronic
924287022 1:242497896-242497918 ATAAAGCAGGAGCAGAGGGAAGG + Intronic
924324002 1:242877185-242877207 GAGAAGCAGGAAGAGAGGGAAGG + Intergenic
924394501 1:243604643-243604665 GAACCTGAGGAGCAGAGGAAAGG - Intronic
1063418581 10:5892262-5892284 GAAAAACAGGAGGAAAAGGAAGG - Intronic
1064068115 10:12201118-12201140 GAAACTGAGGCACAGAGGGAAGG - Intronic
1065876290 10:30000213-30000235 GACAAAGAGGAGCAGAGAGAGGG - Intergenic
1066194297 10:33083832-33083854 GAAAAACAAGAGCAGTGAGACGG - Intergenic
1067327095 10:45279848-45279870 GAAAATAATGAGCAGGAGGAAGG + Intergenic
1067477267 10:46575343-46575365 GAACATCAGGAGCAGCAAGAAGG + Intergenic
1067617472 10:47766438-47766460 GAACATCAGGAGCAGCAAGAAGG - Intergenic
1068206285 10:53859021-53859043 GAAAAAAAGGAGGAGAGGGAAGG - Intronic
1068456248 10:57257520-57257542 AAAGACCAGGAGTAGAGGGATGG - Intergenic
1068912891 10:62397512-62397534 GAAGATCAGGATCAGGGGGATGG + Intronic
1069461453 10:68599164-68599186 AGAAATCAGGAACAGAGTGAGGG - Intronic
1070521374 10:77256395-77256417 GCAAATCATGAGCTGGGGGAGGG + Intronic
1070523947 10:77278829-77278851 GAAACTGAATAGCAGAGGGATGG - Intronic
1070568301 10:77620383-77620405 GGAAAGCAGGAGCTGTGGGAGGG + Intronic
1070723655 10:78773564-78773586 GGAAATCAGGAGGAGAGTGAGGG - Intergenic
1071437184 10:85658218-85658240 GAAAGGAAGGAGAAGAGGGAAGG - Intronic
1071683198 10:87728413-87728435 GAAACTGAGGCCCAGAGGGAGGG - Intronic
1072301561 10:94067084-94067106 GAAAATCAGAAGCAGAGATAGGG - Intronic
1073077161 10:100831277-100831299 GAGACACAGGTGCAGAGGGAGGG - Intergenic
1073332888 10:102682296-102682318 GACCATCAGGAGCAGAGAGTAGG - Intronic
1074111162 10:110423598-110423620 GGAAATCAGGGGAAGATGGATGG + Intergenic
1074128145 10:110546751-110546773 GAAAAACTGGGGCAGAGTGATGG + Intergenic
1074229445 10:111519266-111519288 GAAAAGAAGGAGGAGAGGAAAGG - Intergenic
1074945734 10:118278934-118278956 CAAAATCAGGAGCAGGGGCAAGG - Intergenic
1075419144 10:122288025-122288047 GAAAAGAAGGAAGAGAGGGAGGG - Intronic
1076431353 10:130405094-130405116 GAAAAGTAGCAGCAGAGGGAGGG + Intergenic
1076467275 10:130691918-130691940 GATAATCAGCATTAGAGGGAAGG - Intergenic
1076671662 10:132124201-132124223 GCAAAGCAGCAGCAGAAGGACGG - Intronic
1077231775 11:1461045-1461067 CAACAGCAGGAGCGGAGGGAGGG - Exonic
1077257335 11:1592563-1592585 GAAAATCAACAGAAGAGGGCAGG + Intergenic
1079022829 11:16923615-16923637 GAAAATTGGGAGGAGGGGGAGGG + Intronic
1079146085 11:17853347-17853369 GAAATACAGGAGCAAGGGGAAGG - Intronic
1079244119 11:18740818-18740840 GAGCCTCAGGGGCAGAGGGACGG + Intronic
1080114149 11:28603142-28603164 GAAAATTAGTAGCAGAAAGATGG - Intergenic
1080337331 11:31213004-31213026 GCAAGTGAGGAGCAGAGAGAAGG - Intronic
1080730193 11:34942828-34942850 GAAAAGCAGGAGGAGAGAGAAGG - Intronic
1081686875 11:45049047-45049069 GAAGATGATGAGCACAGGGAAGG + Intergenic
1082882962 11:58056356-58056378 GAAAATCTCCAGCAGAAGGAAGG - Intronic
1083155568 11:60820892-60820914 GAAAATTAGCAGCAAAGGGCTGG + Intergenic
1083759066 11:64806024-64806046 AAAAATTAGGAGGAGAGGGGAGG + Intronic
1083838862 11:65291499-65291521 GCAAATCTGGGGAAGAGGGAAGG - Intronic
1084513996 11:69625835-69625857 GAAAATCAGGAGGGGTGGGGTGG - Intergenic
1084853969 11:71968420-71968442 GAAAATCAGGAACAGCAAGATGG - Intronic
1086188099 11:84044011-84044033 GAAAATAAGGAAGAGAGGGAGGG - Intronic
1087700289 11:101429603-101429625 AAAAACCAGGAGCAGAAGGTAGG - Intergenic
1088298153 11:108323763-108323785 GAAGAAGAGAAGCAGAGGGAAGG + Intronic
1088799205 11:113289877-113289899 TCAATTCAGGAGCAGAGGGGAGG - Intergenic
1089187704 11:116631523-116631545 AAAAACCAGGAAAAGAGGGAAGG - Intergenic
1089308727 11:117543946-117543968 GAAAACCAGAAGCTGAGGAAGGG + Intronic
1090533081 11:127611475-127611497 GAAAATCAGGGGAAAAGGGGAGG + Intergenic
1090712413 11:129399622-129399644 GTACAGCAGCAGCAGAGGGACGG + Intronic
1091148087 11:133298306-133298328 TAAATTCAGGAAGAGAGGGATGG + Intronic
1091148881 11:133307221-133307243 GAAAATGAGAAGCAAAGAGAAGG + Intronic
1091412013 12:248029-248051 AAAAAGCAGGAGGAGAGGGAAGG + Intronic
1091477401 12:789085-789107 TGAAATCAGGAGTAGAGGAAAGG + Intronic
1091743820 12:2978104-2978126 GAAATACAGGAGCAAAGGAAAGG - Intronic
1092005319 12:5064453-5064475 CAAAAGGAGAAGCAGAGGGAAGG + Intergenic
1092031837 12:5293036-5293058 GCAAATCAGAAGCAGTGGGATGG + Intergenic
1092433841 12:8430616-8430638 GAAAGCCAGGAACAGAGGCAAGG + Intergenic
1092476462 12:8823047-8823069 GAAAATGAGGTGCATAAGGAAGG + Intronic
1092490619 12:8941636-8941658 GAAAATAAGGAACAAAGGGAAGG + Exonic
1092885968 12:12924644-12924666 GAAAATCAAGGTCACAGGGATGG - Intergenic
1093183184 12:15989298-15989320 GAAAATAAGGATCAAAGTGATGG - Intronic
1093763643 12:22938211-22938233 GAGGTTCAGGAGCAAAGGGATGG + Intergenic
1093917661 12:24823689-24823711 GAACAGGAGGAGGAGAGGGAGGG - Intronic
1094130003 12:27064505-27064527 GAACATCATGAACAGAAGGAAGG - Intronic
1096157191 12:49347260-49347282 GAGAAACGGGAGCAGAGGGTTGG - Exonic
1096456717 12:51793461-51793483 GCAACTCAGGATCAGAGGAAAGG + Intronic
1096498042 12:52050107-52050129 GAAAAGTAAGAGAAGAGGGAAGG - Intronic
1096669490 12:53190105-53190127 GAAACTCAGGAGCAGGTGGTTGG + Exonic
1096939129 12:55321924-55321946 GAACATCAGTAGCATAGTGAAGG - Intergenic
1097695795 12:62773782-62773804 GAACATCAGGAGCAGGGTGGGGG + Intronic
1098060137 12:66553308-66553330 GGAAATGAGGAAGAGAGGGAGGG - Intronic
1098627844 12:72695143-72695165 AAAAATTAGAAGGAGAGGGAAGG - Intergenic
1098669072 12:73201700-73201722 TAAAAACAGGACCAGAGGCATGG - Intergenic
1098897260 12:76078112-76078134 GCAAAACAGGAGCAGAAGGAAGG + Intronic
1099752212 12:86790370-86790392 GAACCTAAGGAGAAGAGGGAGGG + Intronic
1099990684 12:89717779-89717801 GATATTCTGGTGCAGAGGGATGG + Intergenic
1100168827 12:91949270-91949292 GAAAATCAGAAGAAAAGGAAAGG + Intergenic
1100299981 12:93297949-93297971 GAAAAACAGGAGCAGAAACAAGG - Intergenic
1100587756 12:95995560-95995582 GAAAATGATGAGCAGAGGTCAGG - Intronic
1101268779 12:103120410-103120432 GATAATCATTTGCAGAGGGATGG + Intergenic
1102146569 12:110659008-110659030 CAATTTCAGGAGCAGAAGGAAGG - Intronic
1102561701 12:113766806-113766828 GAAACTGAGGCACAGAGGGAGGG - Intergenic
1103834429 12:123807726-123807748 GAGAAAGAGGAGGAGAGGGAGGG + Intronic
1104047895 12:125176130-125176152 GAGGCTCAGGAGCAGTGGGAGGG - Intergenic
1104398697 12:128457770-128457792 GAAAATGAGGAATAGTGGGATGG + Intronic
1104809610 12:131612390-131612412 GATAACATGGAGCAGAGGGAAGG + Intergenic
1105578298 13:21672767-21672789 GAAAAGCAGGGGCAGAGGCTTGG + Intronic
1105964214 13:25370656-25370678 GAAAATTAGAAGCAGAGGCCGGG + Intergenic
1106619887 13:31362985-31363007 GAATATAAGTGGCAGAGGGAGGG - Intergenic
1106794365 13:33189397-33189419 GGAAAGCAGGAGGAAAGGGAAGG - Intronic
1106794384 13:33189446-33189468 GGAAAGCAGGAGGAAAGGGAAGG + Intronic
1107070517 13:36263080-36263102 GAAAAGGAGTAGGAGAGGGAGGG + Intronic
1107255985 13:38427364-38427386 GAGAGTCATGAGCAGTGGGAGGG - Intergenic
1107754600 13:43606651-43606673 GAATAGTAGGAGCAGGGGGAAGG + Intronic
1108690517 13:52855540-52855562 GAAAATCAGGTGCAGGGAAAGGG + Intergenic
1110192991 13:72752843-72752865 GCAAGTTAGGATCAGAGGGAAGG - Exonic
1110263594 13:73513587-73513609 GAAAAGGAGAAGCAGAGGAATGG + Intergenic
1110539904 13:76696421-76696443 GACAGACAGGAGTAGAGGGATGG - Intergenic
1111020632 13:82444774-82444796 AAAAATCAGGAGGAGGGGAAAGG - Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111695371 13:91616906-91616928 GAAAATCAGAATCAGTGTGAAGG - Intronic
1112258512 13:97856741-97856763 TAAACTCAGGAGCACAAGGAGGG + Intergenic
1112344518 13:98577815-98577837 GAAAATGGGGCGCAGAGGGCAGG + Intronic
1114824107 14:26056175-26056197 GAACAGCAGGAGGAGAGAGAGGG - Intergenic
1114885439 14:26843913-26843935 AAAAAGCAGGAGGAGAGGGGAGG - Intergenic
1114937990 14:27568531-27568553 GAAGAACAGAAGCAGTGGGAGGG - Intergenic
1115154867 14:30327040-30327062 GGAAATGAGGAGCAGAGTAATGG + Intergenic
1116434783 14:44884959-44884981 GAAAATATGGAGTAGAAGGATGG + Intergenic
1116503529 14:45650178-45650200 GAAAATCTGCAGCAATGGGATGG + Intergenic
1117977917 14:61316896-61316918 GAAAATGAGGAACAGGGAGAGGG + Intronic
1117982682 14:61357479-61357501 GAAAATTAGAAAGAGAGGGAGGG - Intronic
1118451237 14:65904470-65904492 GAAAATTAGGTGCAGGGGAAAGG - Intergenic
1120728699 14:87977507-87977529 GCAAATCAAGAGCAGAGAAAAGG + Intronic
1121254103 14:92518997-92519019 GAAAATGAGGTCCAGAGGGAAGG - Intronic
1121657089 14:95605074-95605096 GAAAAAAAGGGGCAGGGGGAAGG - Intergenic
1121919267 14:97865651-97865673 GAAAGACAGAAGCAGATGGAGGG - Intergenic
1122055550 14:99095932-99095954 GAGAGTCAGCAGCAGAGGGCAGG - Intergenic
1122159910 14:99775425-99775447 GGAAATGTGGAGCAGTGGGAAGG + Intronic
1122179230 14:99943603-99943625 GAAATTCAAGAGCACAGGGTAGG + Intergenic
1122388865 14:101366711-101366733 GTCTCTCAGGAGCAGAGGGAGGG + Intergenic
1123197666 14:106631753-106631775 GATTTTCAGCAGCAGAGGGAGGG + Intergenic
1124216564 15:27812340-27812362 GCAAGTCAGGAGCACAGGGAGGG + Intronic
1124216922 15:27815271-27815293 CACAGTCAGGAACAGAGGGAAGG + Intronic
1124683429 15:31757125-31757147 GAAAAGCAGGAGCTGGGGTATGG - Intronic
1124990252 15:34666270-34666292 GAAACTCAGGAGCAGTCAGAAGG + Intergenic
1125887182 15:43237853-43237875 GAAATCCTGGAGCAGAGTGAGGG - Intronic
1126362899 15:47864436-47864458 TAAAATCATGGGCAAAGGGAAGG - Intergenic
1126841311 15:52719938-52719960 GGACAGCAGGAGCAGAGGCAAGG - Intergenic
1127168606 15:56274935-56274957 GAAACTCAGGAACACAGGGAAGG - Intronic
1127788611 15:62378608-62378630 GAAAAGAAGGAAGAGAGGGAGGG + Intergenic
1128522401 15:68384515-68384537 GAAAATGAGCTGCAGAGGGCTGG - Intronic
1128534400 15:68479763-68479785 AAAAGGCAGGAGCAGTGGGAGGG - Intergenic
1128652429 15:69428279-69428301 GGAAATCAGGTGCATATGGAAGG - Intronic
1128767905 15:70262284-70262306 GCAAAGCAGGGGGAGAGGGAGGG - Intergenic
1128966545 15:72064127-72064149 GAAAATAAAGAGTAGAGTGATGG + Intronic
1129922915 15:79335760-79335782 GAGAATTAGGAGGTGAGGGAAGG + Intronic
1129959308 15:79668943-79668965 GCAAAGAAGGAGCAGAGGAAAGG - Intergenic
1130132268 15:81153951-81153973 GAAAAACAGGTGCACAGGAAAGG + Intergenic
1130155011 15:81342879-81342901 GAAAATTAGGAGGAAATGGAGGG + Intronic
1130523479 15:84683203-84683225 GAAAGTCAGGAACAGCAGGAAGG + Intronic
1130705685 15:86230981-86231003 GAAACTGAGGACCAGAGAGAGGG + Intronic
1131705972 15:94996652-94996674 GAAAAAAAGGAGGAGAGGGGAGG - Intergenic
1131734193 15:95314506-95314528 GAAAAACAGAAGCTGAGGAAGGG - Intergenic
1131981202 15:97996517-97996539 GGAAATGAGGAGGAGAGGCAAGG + Intergenic
1132284055 15:100646806-100646828 GAAAATCAGGAGGAGACCCATGG - Intronic
1132702373 16:1227322-1227344 GCAGAACAGGAGCCGAGGGATGG + Intronic
1132705951 16:1243546-1243568 GCAGAACAGGAGCCGAGGGATGG - Intergenic
1132998371 16:2836196-2836218 GACAAGCAGGAGCAGAGGCAGGG - Intronic
1133392401 16:5420931-5420953 GAAAAGCAGGAGGAAGGGGAGGG - Intergenic
1133740061 16:8644685-8644707 GTAAACCAGGAGCTGTGGGAAGG - Exonic
1134523569 16:14928961-14928983 GAAGAAGAGGAGCAGGGGGAAGG - Intronic
1134806320 16:17128940-17128962 CCAGATCAGGACCAGAGGGAAGG - Intronic
1135116217 16:19725490-19725512 GAAAATCAGGGGCCCAGGCATGG - Intronic
1135547546 16:23376038-23376060 GAAATTGAGGAGCAGAGAGAAGG - Intronic
1135763408 16:25155966-25155988 GAAAATCAGGAGCAGGTGCGGGG - Intronic
1135960895 16:26993676-26993698 GAAATTTAGGAGCAGAGACAGGG + Intergenic
1136248248 16:28987204-28987226 GAAAATCAGAAGAACAGGGCCGG - Intronic
1136677119 16:31920709-31920731 GCAAAGCAGGAGCAGCTGGAAGG - Intergenic
1136901076 16:34038655-34038677 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1136968338 16:34942061-34942083 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1137916250 16:52433570-52433592 GAAACTGAGGAACAGAGGGGTGG - Intergenic
1137949693 16:52771781-52771803 GAAGATAAGGAGCCAAGGGAAGG + Intergenic
1138083146 16:54110886-54110908 CAAAATGAGGATCAGAGAGAAGG - Intronic
1138262770 16:55637194-55637216 GAAAGTCAGTAGCTGAGGCAGGG + Intergenic
1138313911 16:56051991-56052013 GCAAATCAGGAGAAAATGGATGG + Intergenic
1139639897 16:68283776-68283798 TGAGATCAGGAGAAGAGGGAAGG + Intronic
1140244046 16:73232245-73232267 GGGAATCAGGAGCAGGGGCAGGG - Intergenic
1140456147 16:75106672-75106694 AGAAAGCAGGAGCAGAGGGAAGG + Intronic
1140467146 16:75191596-75191618 CAAAATTAGGAGCAGGGGGAGGG + Intergenic
1140483950 16:75279353-75279375 GAATATCAGGAGGAGAGAGAAGG + Intergenic
1140621934 16:76745401-76745423 GAAAATGAGGAAGAGAGAGATGG + Intergenic
1140799895 16:78476857-78476879 GGAAATCAGGAAGGGAGGGAAGG - Intronic
1141206327 16:81935692-81935714 GGAGAACAGGAGGAGAGGGAAGG - Intronic
1141773009 16:86102267-86102289 GAAAAAGAGGAAGAGAGGGAGGG - Intergenic
1141815712 16:86408142-86408164 GAAAGGCAGGAGGAGAGGGTGGG - Intergenic
1142310719 16:89311869-89311891 GAAAATCAGGAACACAGGGAAGG + Intronic
1143135924 17:4712152-4712174 GAAAACCAGAAGCAAAGGGGAGG + Intronic
1143252520 17:5533801-5533823 CCACATCAGGGGCAGAGGGATGG + Intronic
1143743015 17:8967386-8967408 GAAGAAGAGGAGAAGAGGGAAGG + Intergenic
1144265079 17:13561324-13561346 GAAAATCAGGAGCAGAGGGAAGG - Intronic
1145009743 17:19361296-19361318 GAAAACCAGGTGGCGAGGGATGG - Intronic
1145867996 17:28253088-28253110 GAAAGTCCGGAACAGAGAGAAGG + Intergenic
1150153504 17:62830735-62830757 GAATAGGAGGAGCACAGGGAGGG - Intergenic
1150230419 17:63546636-63546658 AACCATCAGGAGCAGAGGGCTGG - Exonic
1150278762 17:63916817-63916839 TAAAATCAGAAGGACAGGGAAGG + Intronic
1150429920 17:65106849-65106871 CAAGATCAGGTGCACAGGGAAGG - Intergenic
1150979237 17:70123001-70123023 GAAATTTAAGAGCAGAAGGAGGG - Intronic
1151028010 17:70702646-70702668 GAAGATCAGGAGGTGGGGGAAGG - Intergenic
1152002582 17:77655806-77655828 GACAATGGGGAGGAGAGGGATGG - Intergenic
1153324549 18:3804589-3804611 CAGATTCAGAAGCAGAGGGAGGG + Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155557155 18:27032502-27032524 GAAAAGAAGGAAGAGAGGGAAGG - Intronic
1156074285 18:33254724-33254746 GAAGAGGAGGAGCAGATGGAAGG + Intronic
1156834123 18:41531811-41531833 GAAAACCAGAGGAAGAGGGAGGG - Intergenic
1157119404 18:44895141-44895163 GAAAGAAAGGAGAAGAGGGAAGG + Intronic
1157258226 18:46157103-46157125 GAAAAACAGCAGCACAGAGAAGG + Intergenic
1157289928 18:46402314-46402336 GAAAATCAGATTTAGAGGGAAGG - Intronic
1157394664 18:47331643-47331665 GAAAAGAAGGGACAGAGGGAGGG - Intergenic
1157400631 18:47383560-47383582 GAAAAGGAGGAAGAGAGGGAGGG - Intergenic
1157502237 18:48199647-48199669 GAGAATGAGGAGGAGCGGGAGGG - Intronic
1157556306 18:48615316-48615338 GAGAAGAAGGAGCAGAGAGAGGG - Intronic
1157936978 18:51883994-51884016 GAAAACCAGGAGGAGAGTAAAGG + Intergenic
1158369032 18:56776834-56776856 GTAAAGCAGGAGCAGAAGGAGGG - Exonic
1158397908 18:57094275-57094297 TAAAATCAGTAAAAGAGGGAAGG + Intergenic
1158901294 18:61964222-61964244 GAAAATTAGGAGCAAAGTGTAGG + Intergenic
1160044802 18:75376833-75376855 GAGATTCAGCAGCAGAGAGAGGG - Intergenic
1160202311 18:76806146-76806168 TAAAAGCAGAAGCAGAGAGAGGG + Intronic
1160373484 18:78392924-78392946 GACATTCAGGAGCAGAGAGCTGG + Intergenic
1161116407 19:2499305-2499327 AGACATCTGGAGCAGAGGGAGGG - Intergenic
1161514458 19:4688992-4689014 GACAGGCAGGGGCAGAGGGATGG - Intronic
1161772858 19:6240732-6240754 AGAATTCAGGGGCAGAGGGAAGG + Intronic
1162964355 19:14149010-14149032 GAAAAGGAGGGGCAGAGAGATGG + Exonic
1163082339 19:14953078-14953100 GAACATGGGGAGCAGATGGAGGG + Intronic
1163249335 19:16117190-16117212 GAAAGTTTGGAGCAGAGGGCCGG + Intronic
1165059831 19:33199740-33199762 CCACATCAGGAGCAGAGGAAGGG - Intronic
1165208756 19:34215279-34215301 GAGAATCAGGAGCACAGGCGAGG + Exonic
1165699909 19:37929642-37929664 GGGAGTCAGGAGCAGAGAGATGG - Intronic
1165859239 19:38898550-38898572 GTAAAAATGGAGCAGAGGGAGGG + Intronic
1166202853 19:41249816-41249838 GAATACCAGAAGCAGAGAGAGGG + Intronic
1166856172 19:45783571-45783593 GAAAAGCCGGAGCCCAGGGAGGG - Exonic
1167197916 19:48043642-48043664 AAAAGTCAGGAGCAAAGAGAAGG - Intronic
1167413139 19:49356685-49356707 GAGGGACAGGAGCAGAGGGAAGG + Intronic
1168125687 19:54281293-54281315 GGAATTGAGGTGCAGAGGGACGG - Intergenic
1168400270 19:56081584-56081606 GGAAAGCAGGCTCAGAGGGAAGG - Intergenic
1168403705 19:56100104-56100126 GGAAGTCAGGAGCTGAGGAAGGG + Intronic
1168510138 19:56967299-56967321 GAAAATGAGGAGGAGGGGAAGGG - Intergenic
1168681354 19:58318309-58318331 GGGAGTCAGGAGCAGAAGGAGGG - Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925196642 2:1931188-1931210 GCAGATGAGGAGCAGAGGGAAGG - Intronic
926152789 2:10434260-10434282 GGGAACCAGGGGCAGAGGGAGGG + Intergenic
926302253 2:11612791-11612813 GAGAATCAGGAGAAGGGGCACGG - Intronic
926394858 2:12430440-12430462 GAAAGGAAGGAGGAGAGGGAGGG + Intergenic
926395220 2:12434468-12434490 GAATTTGAGGAGCAGAGGAAAGG + Intergenic
926443246 2:12912071-12912093 GAAAATCAGGATAAGAAAGAAGG + Intergenic
926571972 2:14538988-14539010 GAAAACCATAAGCAGAGGCAAGG + Intergenic
927233821 2:20851569-20851591 GAATTTCATGAGCAGAGTGATGG + Intergenic
927948730 2:27153211-27153233 AAAAGGCAGGTGCAGAGGGAGGG + Exonic
928427528 2:31191594-31191616 GAAATTCTGGAAAAGAGGGAGGG + Intronic
928935889 2:36677557-36677579 CAAAATTAGGGGAAGAGGGAGGG + Intergenic
929625255 2:43400145-43400167 AAAAGTCAGGAGCAAAAGGAGGG - Intronic
929763951 2:44828748-44828770 GAAAAGGAGGAACGGAGGGAGGG + Intergenic
929969487 2:46561803-46561825 AAAAATGCGGTGCAGAGGGAGGG - Intronic
930829960 2:55732582-55732604 CAAAATCAAGGGCAGAGAGAGGG - Intergenic
932019897 2:68073729-68073751 CACAGTCAGGAGCTGAGGGATGG + Intronic
932196561 2:69788882-69788904 GGAAAGAAGGAGGAGAGGGAGGG + Intronic
932415927 2:71573981-71574003 GAAAATCAGGAGGGGAGGCCAGG - Intronic
932488226 2:72099761-72099783 GAAAAAGAGAAGGAGAGGGAAGG + Intergenic
933206688 2:79514180-79514202 GAAAATAGGGAGCAGAAGGGTGG + Intronic
933435036 2:82238352-82238374 TAAAATAAGGAGCAGGGGGGTGG + Intergenic
933866458 2:86522641-86522663 GAAGAACAGGTGCAGAGTGAAGG - Intronic
933871577 2:86571102-86571124 GGAGATCAAGAGCAGAAGGATGG + Intronic
934618986 2:95792653-95792675 GAAAGACAGAAGCAGAGGCATGG - Intergenic
934641905 2:96031904-96031926 GAAAGACAGAAGCAGAGGCATGG + Intronic
934683941 2:96306614-96306636 AGAAAACAGGAGCAGTGGGAAGG - Intergenic
934870002 2:97855018-97855040 TGAAGTCAGCAGCAGAGGGAAGG - Intronic
935144743 2:100387947-100387969 CAAAATCAGAGGCAGAGGCAGGG + Intergenic
935534980 2:104283566-104283588 GCCGCTCAGGAGCAGAGGGAGGG + Intergenic
935593593 2:104863119-104863141 GAAGAACAGGATCAGAGGGTAGG - Intergenic
936276484 2:111102156-111102178 CAAGGTCAGGAGCAGATGGAAGG - Intronic
936385779 2:112027768-112027790 GAAGATCAGGAGCAGGGGTGAGG - Intronic
936500477 2:113062398-113062420 CAGAAGCAGGGGCAGAGGGAGGG - Intronic
937953718 2:127407903-127407925 GAGAGACAGGAGCAGAAGGAGGG - Intergenic
938519150 2:132048838-132048860 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
939303860 2:140384064-140384086 GAAAAGCAGGAGAAGAAGGAAGG - Intronic
939750512 2:146039457-146039479 GAATCTCTGGAGAAGAGGGAAGG - Intergenic
941903151 2:170696843-170696865 GAAAATCAGGAGAGGAGGGAAGG - Intergenic
943464909 2:188217549-188217571 GAAAGAAAGGAGGAGAGGGAAGG - Intergenic
943470365 2:188287885-188287907 GGAAACCAGGAGTAGAGGAAAGG - Intergenic
943830704 2:192458209-192458231 GAAATTGAGGAGCAGGGGGAGGG - Intergenic
943889074 2:193262624-193262646 GAAAATGAGGATAAGAGGGGTGG + Intergenic
944245671 2:197528567-197528589 GAACATCAGGAGCAGGGAGCAGG - Intronic
944469848 2:200041432-200041454 GAGAAACAGGACTAGAGGGAAGG - Intergenic
944783105 2:203040216-203040238 GCAAAGAAGGAGCAGAGGAAAGG + Intronic
945062985 2:205924763-205924785 GAAATTCAGGAGCAGGGCAATGG + Intergenic
945153771 2:206815890-206815912 GAAAGTCAGTAGCAGAGTGAAGG - Intergenic
945160790 2:206888419-206888441 TAATATCAGGAGAATAGGGAAGG + Intergenic
946150309 2:217761161-217761183 GCAAAGAAGGAGCAGAGGAAAGG - Intergenic
946192536 2:218015172-218015194 GTAAATCAGGGGCAGGGGCAGGG - Intergenic
946799433 2:223395598-223395620 GAAGATCAGGAACAAAGGTAAGG - Intergenic
946923302 2:224601862-224601884 AAAAAACAGGAACAGAGGAAAGG + Intergenic
947306429 2:228753433-228753455 GCAAAGAAGGAGCAGAGGAAAGG + Intergenic
947386333 2:229594290-229594312 GAAAAAGAAGAGCAGAGGGCCGG + Intronic
947529781 2:230901473-230901495 GAAGAGCAGGAGGAGAGAGATGG + Intergenic
948625465 2:239265564-239265586 GAGAGTCAGGGGCAAAGGGAGGG - Intronic
948726470 2:239937063-239937085 ACGAATCAGGAGCAGAGGGGAGG + Intronic
1168842483 20:918325-918347 TAAGGTCAGGAGCAGAGTGAGGG - Intergenic
1169004687 20:2196799-2196821 GAAACTGAGGATCAGAGGGATGG + Intergenic
1169185571 20:3614202-3614224 AGAAAGCAGGGGCAGAGGGAAGG - Intronic
1169522810 20:6391376-6391398 GAAACTCAGGAGGTCAGGGAAGG - Intergenic
1169687874 20:8296588-8296610 AAAAAGAAGGAGCAGAGGGATGG + Intronic
1169815596 20:9652869-9652891 AAACATCATGATCAGAGGGAAGG - Intronic
1169929316 20:10815526-10815548 GAAAAGCAGAACCAGAGGCAAGG + Intergenic
1170354539 20:15477883-15477905 TAACAGCAGAAGCAGAGGGAGGG + Intronic
1170460240 20:16570985-16571007 GAACATCTCTAGCAGAGGGATGG + Intronic
1170501809 20:16982425-16982447 GAAAAGCAGGAGGGAAGGGAGGG - Intergenic
1171317137 20:24205287-24205309 GAAAGAGAGGAGCAGAGGGCAGG + Intergenic
1172005285 20:31815393-31815415 CTCAAACAGGAGCAGAGGGAAGG + Intergenic
1172011128 20:31846542-31846564 GAAAAGCAGGAGTAGAGGTAGGG - Intergenic
1172800465 20:37572873-37572895 GAAAATGAGGCACAGAGAGATGG + Intergenic
1173112282 20:40203211-40203233 GAAAAGCAAGAGGAGGGGGAGGG + Intergenic
1173224455 20:41154119-41154141 GAAAATGAGGCTCAGAGAGATGG + Intronic
1173853656 20:46235408-46235430 GGAAGTCAGCAGCAGAGAGAGGG - Intronic
1174064376 20:47853875-47853897 GACCAGCAGGTGCAGAGGGAGGG + Intergenic
1174620216 20:51868388-51868410 GAAAAAAAAGAGCAAAGGGAAGG - Intergenic
1174686606 20:52462034-52462056 GTAACTCAGGGGGAGAGGGAGGG - Intergenic
1175073396 20:56353622-56353644 GAGAAGCAGGAGCAGCAGGAGGG - Intergenic
1175357517 20:58380586-58380608 AAGAATCAGGAGCACAGGGTAGG + Intergenic
1175492180 20:59386748-59386770 GAAACTGAGGCACAGAGGGAGGG - Intergenic
1176209735 20:63913295-63913317 GAGAAGCGGGAGGAGAGGGAAGG - Intronic
1176742564 21:10617389-10617411 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1177576224 21:22959833-22959855 GAAAAGGAGGTGCAGAGGTACGG + Intergenic
1178502337 21:33136061-33136083 TAAAATCAGGAGCAGGTGGATGG + Intergenic
1178825055 21:36008117-36008139 GAAAATGAGAATCAGATGGAGGG - Intergenic
1179150604 21:38805734-38805756 GAGAAGCGGGAGGAGAGGGAAGG - Intronic
1179477320 21:41655729-41655751 GATGATCAGGGGCAGAGGGGAGG - Intergenic
1179601393 21:42479999-42480021 GCAAAGCAGGAGAAGAGGCAAGG + Intronic
1180609677 22:17086965-17086987 GTAAGTCAGGAGCAGAAGCACGG + Intronic
1180734051 22:18002333-18002355 GAAAATATAGAGCAGAGGGCGGG + Intronic
1180897275 22:19345841-19345863 GAAAATGAGAAGCAGAAGGTTGG - Intronic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181410859 22:22718089-22718111 AAAAATTAGAGGCAGAGGGAGGG + Intergenic
1181906772 22:26203869-26203891 GAAGAGTAGGAGCAGAGAGAGGG + Intronic
1181939502 22:26464330-26464352 GCATCTCAGGAGCAGAGGGAGGG + Exonic
1182811172 22:33118084-33118106 TAAAATTAGGACCAGAGGCAGGG + Intergenic
1183091786 22:35527193-35527215 AAAAGGCAGGAGAAGAGGGAGGG + Intergenic
1183562412 22:38585937-38585959 GAAAAGCAGGAGTAGAGAGTTGG - Intronic
1184852470 22:47128318-47128340 GAAAATGTGGAGCAGATGGGTGG - Intronic
1184863780 22:47191601-47191623 GAAAAGCAGGAGGAGAGAGACGG + Intergenic
1184879535 22:47296219-47296241 GAAACTGAGGCCCAGAGGGATGG - Intergenic
1184902787 22:47457914-47457936 GAAAAGCAGGAGGAGGAGGAAGG + Intergenic
1185172580 22:49302374-49302396 GATAAGCAGGAGCCCAGGGAAGG - Intergenic
1185403899 22:50634332-50634354 GAAAAACAGGTGCAGCTGGAAGG - Intergenic
1203237720 22_KI270732v1_random:21962-21984 GAAAATAAAGAGGAGAAGGAGGG + Intergenic
949285862 3:2403461-2403483 GAAGAGCAGGGACAGAGGGACGG - Intronic
949571522 3:5298138-5298160 GCAAACCAGGAGCAAAGAGAAGG + Intergenic
950173612 3:10856264-10856286 GATAACCAGGAGCAAATGGAGGG + Intronic
950583381 3:13877638-13877660 GAAACTGAAGTGCAGAGGGAAGG - Intronic
950832836 3:15892194-15892216 GAAGATCAGCAGCAGAGAGAAGG - Intergenic
951035301 3:17926004-17926026 GAAACTCAGGAGCTCAGGCAAGG + Intronic
951188609 3:19743176-19743198 TAAAATCCAGAGAAGAGGGAGGG + Intergenic
951711210 3:25586176-25586198 GAACATGAGGAGAAGAGGGTGGG - Intronic
951814205 3:26735483-26735505 GCAAATATGGAGTAGAGGGAAGG - Intergenic
951931387 3:27970984-27971006 GAAAGGCAGCAGCAGAGGTAAGG + Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952794626 3:37227851-37227873 GAAAATAGGGAACAGGGGGAAGG + Intergenic
952936198 3:38400148-38400170 GCAAATGAGTAGCAGGGGGAAGG - Intronic
952956728 3:38562318-38562340 GGACATCAGAAGCACAGGGAGGG + Intronic
953247417 3:41207438-41207460 GAAGTTCAGGAGAAAAGGGAAGG - Intronic
953369350 3:42374145-42374167 CAAGATAAGGAGCAGATGGAAGG - Intergenic
954365241 3:50142459-50142481 GAAAGTAAGGAAGAGAGGGAGGG - Intergenic
954370000 3:50165205-50165227 GAAGAGCTGGAGCACAGGGAGGG + Intronic
955990386 3:64620949-64620971 GATAATCAGTTCCAGAGGGATGG + Intronic
956659644 3:71584333-71584355 GAAAATAAGGGGCAGGGGGGCGG + Intergenic
956728971 3:72179119-72179141 GAAAACCAGCAGAAGCGGGAAGG + Intergenic
957158690 3:76580087-76580109 CTAAATCAGGAGCAGAGGGCAGG - Intronic
957379192 3:79403124-79403146 GAAAAACAGAAACAGAGGGTGGG - Intronic
957687480 3:83520755-83520777 AAAAAGGAGGAGCAGATGGAGGG - Intergenic
957715871 3:83929038-83929060 GAAAATCATCAGCAGAGAAATGG + Intergenic
958091270 3:88879823-88879845 GAAAAGAAGGACCAGAGAGAAGG + Intergenic
958181568 3:90067394-90067416 GAAAAAGAGGAAGAGAGGGAGGG + Intergenic
958801017 3:98755953-98755975 GAAAATCATTAGAAGAGGAAGGG - Intronic
959349897 3:105249062-105249084 AAAAAGCAGGAGCAAAAGGAGGG - Intergenic
959526298 3:107381245-107381267 GAAAAACAGGAGCAGAGGGCGGG + Intergenic
960711888 3:120538404-120538426 GAAACTCACGAGCAGAGTGAGGG - Intergenic
960955653 3:123028491-123028513 TAACATCAGGAACAGTGGGAGGG + Intronic
961135970 3:124511624-124511646 GAGGAGCAGGGGCAGAGGGAAGG - Intronic
961838409 3:129684801-129684823 GAAAATTAGGAGCAGATAGATGG + Intronic
961908183 3:130284521-130284543 GAAAATAAGGATCAGAGGGCTGG + Intergenic
962049750 3:131800601-131800623 CAACATCAGGAGCAGTAGGAGGG - Intronic
963952131 3:151214491-151214513 GAAAAGGAAGAACAGAGGGAGGG - Intronic
965110064 3:164409624-164409646 GGAAAGGAGGAACAGAGGGAAGG - Intergenic
966638283 3:182159825-182159847 GAACATCAGGGGCACAGGGAGGG - Intergenic
966678066 3:182610782-182610804 GCAAAGAAGGAGCAGAGGAAAGG + Intergenic
967268183 3:187710180-187710202 GAGAATCAGGAGTTGAGGGCAGG - Intronic
967877639 3:194277698-194277720 GTAAATCAGGGCCAGAGGGATGG - Intergenic
968185704 3:196632513-196632535 CACAATCAGGGGCAGGGGGAGGG - Intergenic
968481933 4:837104-837126 GGGCACCAGGAGCAGAGGGAAGG - Intergenic
968492900 4:899980-900002 GAAAATCAGATGCAGAGCGTGGG + Intronic
969154241 4:5196129-5196151 GAAATGCAGGTGGAGAGGGAGGG + Intronic
969666819 4:8562603-8562625 CTAAATCAGGAGAAGATGGAAGG + Intronic
970027478 4:11638994-11639016 GAAAATGAGGAACAGAGAAAAGG + Intergenic
970227496 4:13874862-13874884 GAAAGAGAGGAGCAGATGGATGG - Intergenic
970501820 4:16685579-16685601 GAAATTAAGTAGCAGGGGGAAGG + Intronic
970901952 4:21169803-21169825 GAAAATCAGGACCAAAGGCTGGG - Intronic
971370377 4:26014403-26014425 GGACATCCGTAGCAGAGGGACGG + Intergenic
972186297 4:36532468-36532490 GGAAATAAGGAAAAGAGGGAGGG - Intergenic
972565516 4:40265662-40265684 GAGAGGGAGGAGCAGAGGGAAGG + Intergenic
972865835 4:43231248-43231270 AAAAATCACCAGCAGAAGGAGGG + Intergenic
973725609 4:53772678-53772700 GAAAATAAGGTACAGAGAGAGGG + Intronic
974207605 4:58726502-58726524 AAAAATCAGAAGCAGGAGGAAGG + Intergenic
974470113 4:62308744-62308766 GGAGATCAAGAGTAGAGGGATGG + Intergenic
974996027 4:69160236-69160258 GAAAATGAAGAGTGGAGGGATGG + Intronic
976469788 4:85414996-85415018 GACACTGAGGAACAGAGGGAGGG + Intergenic
976576743 4:86681087-86681109 GAATATTAAGAGCAGAGAGAGGG + Intronic
977084677 4:92577853-92577875 GAAAATGAGGAGCTGATGAATGG + Intronic
977121793 4:93111029-93111051 GAAAATTAAGAGCAGTGCGAGGG + Intronic
977698267 4:99991347-99991369 GCAAAGAAGGAGCAGAGGAAAGG - Intergenic
978109682 4:104947564-104947586 GAAAAACAAGATCAGAGGGCGGG - Intergenic
978598093 4:110400382-110400404 GCAAAGAAGGAGCAGAGGAAAGG - Intronic
978969298 4:114783424-114783446 GAAAATCATGAGCAGGGGTGTGG + Intergenic
979679492 4:123444226-123444248 AAAAATCAGGGAGAGAGGGAAGG - Intergenic
980674337 4:136055690-136055712 GAAAAACAAAAGCAAAGGGAAGG + Intergenic
980757844 4:137189834-137189856 TAAAATCATGAGGAGAGGGGAGG + Intergenic
981695892 4:147558411-147558433 GAAAAGCAGGAGGAGGAGGAGGG + Intergenic
982271587 4:153594834-153594856 GAAAATGAGAAGGAGAGAGAGGG - Intronic
983061614 4:163166994-163167016 GAAAATCAGGATTAGGGGGTCGG + Intergenic
983403752 4:167299056-167299078 GAATATCAGGATCATTGGGAAGG + Intergenic
985117846 4:186608676-186608698 GAAAACCAGGACCAGAGGTTTGG - Intronic
985771820 5:1816653-1816675 GAAATACCAGAGCAGAGGGAAGG + Intergenic
986158556 5:5201389-5201411 TAAAATGAAGAACAGAGGGAAGG + Intronic
986303654 5:6499431-6499453 GAGAATCAGGAGCACAGAAAAGG - Intergenic
986668503 5:10123825-10123847 GAAAATCAGGTGCCGAGAGTTGG - Intergenic
986735317 5:10663589-10663611 GAGAGGCAGGAGCAGAGAGAGGG + Intergenic
986739801 5:10696107-10696129 GAAGAGCAGGAGGAGGGGGAGGG - Intronic
986845155 5:11743817-11743839 GACAGGCAGGAGCAGTGGGAGGG + Intronic
988201392 5:28074560-28074582 GAAAATGTGTAGCAGAGGGCCGG + Intergenic
988277911 5:29106840-29106862 GAGAAGCAAGAGCAGAGGCAAGG - Intergenic
988995037 5:36706536-36706558 GAAAGTCAGAACCAGAGAGATGG + Intergenic
990481268 5:56213746-56213768 GAACACCAGGACCAGAGGGCAGG + Intronic
990614775 5:57496428-57496450 GAAAAAAAAAAGCAGAGGGAAGG + Intergenic
991172307 5:63642631-63642653 GAAAGGGAGGAACAGAGGGAGGG - Intergenic
991220265 5:64206256-64206278 GATAATTGGGAGCTGAGGGATGG + Intronic
991959881 5:72034015-72034037 GAGATTCAGGAGTAGAAGGATGG - Intergenic
992361468 5:76042667-76042689 GAATAACAGGAGCAGAGCCATGG - Intergenic
992479699 5:77138285-77138307 TAAAAGCAGGGCCAGAGGGAAGG - Intergenic
992558738 5:77929345-77929367 GAAGGGCAGGGGCAGAGGGAAGG + Intergenic
995377832 5:111496734-111496756 GAAAAGGAGGAGGAGAGAGAAGG + Exonic
995688661 5:114799235-114799257 GAAAAGGAGGAATAGAGGGAAGG + Intergenic
995956218 5:117779451-117779473 GCAAAGAAGGAGCAGAGGAAAGG - Intergenic
996022243 5:118604101-118604123 GAAAAAGAGGAGCATAAGGAAGG - Intergenic
996653958 5:125915917-125915939 GAAGATCAAGAGCAGTAGGAGGG + Intergenic
996995152 5:129686754-129686776 CAACATCAGGGGCAGAGGAATGG + Intronic
997730255 5:136166807-136166829 GAAAATCAGGAGAAAAGAAAAGG - Intronic
997829708 5:137139477-137139499 GGACTTCAGGAACAGAGGGAAGG + Intronic
998372224 5:141669308-141669330 GGAAAACTGGAGCAGAGGGTGGG + Intronic
999243114 5:150138831-150138853 GAAAATCATTAGCAGAGGCTGGG + Intronic
999261529 5:150241628-150241650 GAAAAGAAGGAGGAGAGGGGAGG - Intronic
999655306 5:153805045-153805067 GAAAATGAGGATCAGAGGCCTGG - Intronic
1000222538 5:159227720-159227742 AAATATCAGGAGGAAAGGGAAGG + Intergenic
1000469777 5:161627109-161627131 AAAAATAAGGAGCCGAAGGAAGG - Intronic
1000938763 5:167335208-167335230 GGAAAGCAGGAGCAAAGAGAGGG + Intronic
1001075955 5:168628233-168628255 GAAAATAAGATGGAGAGGGAGGG + Intergenic
1001283920 5:170408805-170408827 GAAAAAGAGCAGCAGAGTGAAGG + Intronic
1001795043 5:174495059-174495081 CAAGATCAGGAGGGGAGGGAGGG - Intergenic
1001854104 5:174995829-174995851 GAAAATCCAGAGCACAGGTAAGG + Intergenic
1001946903 5:175786757-175786779 GAAAGGCAAGAACAGAGGGAAGG - Intergenic
1002166685 5:177351937-177351959 GCCAATGAGGAGCAGAGGGATGG + Intergenic
1002330355 5:178436450-178436472 GAAGAGCAGGTGCAGAGGGTGGG + Intronic
1002434513 5:179222448-179222470 GAGAACCAGGAGGGGAGGGAGGG + Intronic
1003234319 6:4282205-4282227 GGAATACAGAAGCAGAGGGAGGG + Intergenic
1003409658 6:5851274-5851296 CAAAATCCAGAGGAGAGGGAAGG - Intergenic
1003585892 6:7389329-7389351 CAAAACCCGGTGCAGAGGGAGGG - Exonic
1003655329 6:8001833-8001855 GAAAATGGGGAGCATAGGGAAGG + Intronic
1003933697 6:10954002-10954024 GGATATCAGGAGCAGAGTGGAGG + Intronic
1004281822 6:14286273-14286295 GGAATTCAGGATCTGAGGGATGG + Intergenic
1004793984 6:19060689-19060711 GCAAACCATGAGCAGAAGGAAGG - Intergenic
1005135072 6:22558879-22558901 CAAACTCAGGCACAGAGGGAAGG + Intergenic
1006337061 6:33426306-33426328 AAGAATCAGGAGCATAGGGGTGG - Intronic
1007220351 6:40274110-40274132 GAAAATGAGGAAGAGAGGGCTGG + Intergenic
1007404061 6:41623435-41623457 AAAAATCAGAGGTAGAGGGAAGG - Intergenic
1008883824 6:56410517-56410539 GGCAATGAGGAGCAGAGGGTTGG - Intergenic
1009248394 6:61268931-61268953 GAAAAACAGGGACAGAGGCAAGG + Intergenic
1009647939 6:66432218-66432240 GAAAGTGAGGAGCAAGGGGAGGG - Intergenic
1011466666 6:87665057-87665079 GGAATTCAGGATCAGAGGGCAGG - Intronic
1011593961 6:88998036-88998058 GAAAAGCAGGTGCAGTTGGAAGG - Intergenic
1012533278 6:100264334-100264356 GAAAATCATGGGCAAAGGTAGGG - Intergenic
1013353571 6:109327784-109327806 GCAAAGAAGGAGCAGAGGAAAGG - Intergenic
1013398459 6:109768029-109768051 GCAGATCTGAAGCAGAGGGATGG + Intronic
1013674501 6:112442788-112442810 GAAATGCAGGAGCAGAGGGGAGG - Intergenic
1015850691 6:137568795-137568817 GAAAAGGAGGAGGAGAAGGAGGG + Intergenic
1016039545 6:139418283-139418305 AATAATTAGGAGCAGTGGGAAGG - Intergenic
1016571960 6:145523644-145523666 GGAAGGCAGGAGAAGAGGGAGGG - Intronic
1016774235 6:147886802-147886824 GGAATTGAGGAGCTGAGGGAAGG + Intergenic
1017130150 6:151101399-151101421 AAAATTCAAGAGCAGAGTGATGG - Intronic
1017302541 6:152879209-152879231 GGGAGTCAGGGGCAGAGGGATGG + Intergenic
1017533833 6:155326121-155326143 GAAAATCAGGCCCTGAGGCAAGG + Intergenic
1018396140 6:163379497-163379519 GATAAACAGGAGCTGAGGGCCGG + Intergenic
1018429746 6:163713528-163713550 GAGAATGAGGAGGAGAGGGTTGG - Intergenic
1018892297 6:167990626-167990648 GGGCCTCAGGAGCAGAGGGACGG - Intergenic
1019059000 6:169242548-169242570 GGAAGTTAGGAGCAGTGGGAAGG - Intronic
1019062468 6:169266149-169266171 GGAGACCAGGAGGAGAGGGAGGG + Intergenic
1019603035 7:1894801-1894823 GAAGAGCAGGAGTAGAGGGTGGG + Intronic
1019777083 7:2918274-2918296 GAAAGTCAGGACCTGTGGGAGGG + Intronic
1020591198 7:10139562-10139584 AAAAAAAAGGAGCAGAGGAAGGG - Intergenic
1020759434 7:12249998-12250020 GTAAATCAGTGGCAGAGAGAAGG + Intergenic
1021107019 7:16648760-16648782 GAAAAGCAGGAACAAAGGGGTGG - Intronic
1021336415 7:19408139-19408161 GGAAATCAGGAGCAGAAAGCAGG - Intergenic
1021886385 7:25144060-25144082 GAACAGCAGGAGCAGAGGTATGG + Intronic
1021895632 7:25232628-25232650 GAAAATCATGGGCAGAGGCCTGG - Intergenic
1022465805 7:30652722-30652744 CAAAATGAGGAGCAGAGGCATGG - Intronic
1022477518 7:30721406-30721428 GAGAATGAGAAGCAGAGAGACGG + Intronic
1023683512 7:42712860-42712882 CAAAATCATGAGGAGAGGGAAGG + Intergenic
1023721409 7:43099123-43099145 GGAAATTAGGACCAGAGGAAAGG + Intergenic
1024632313 7:51260037-51260059 GAGAAGAAGGAGCAGAGGAAAGG - Intronic
1024805257 7:53132004-53132026 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1024889895 7:54187798-54187820 GAAAGTGAGGAGCAGAGGTGGGG + Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1025879348 7:65520015-65520037 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025885147 7:65582916-65582938 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1026245429 7:68615341-68615363 GAAGATGAGGAGAAGAAGGAGGG + Intergenic
1027178791 7:75922861-75922883 GCAAAGGAGGAGCAGAGGGAAGG + Intronic
1027212607 7:76163466-76163488 GCATTTCAGGAGCAGAGGCAGGG + Intergenic
1028198063 7:87930145-87930167 GAAAACCAAGAGGAGATGGATGG + Intergenic
1030184165 7:106744106-106744128 GAGAGTCAGGAAAAGAGGGAGGG + Intergenic
1030978520 7:116157316-116157338 GAAAATAAGAAGAAGAGGAAAGG - Intronic
1031321821 7:120339749-120339771 GAAAACACAGAGCAGAGGGAAGG + Intronic
1031386778 7:121161157-121161179 GAAATCCAGGGGCAGTGGGACGG + Intronic
1031616816 7:123891106-123891128 GAAAAGCAGGAGCAGCTGGAAGG - Intergenic
1032259454 7:130323207-130323229 AAAAAACAGGAGAGGAGGGAGGG - Exonic
1032539256 7:132689726-132689748 GAAGAGAAGGGGCAGAGGGAGGG + Intronic
1032784786 7:135192460-135192482 GAAAATTATGAGGGGAGGGATGG + Intronic
1033019946 7:137714512-137714534 GAGAAGCAGGAGTAGAGAGAGGG + Intronic
1033442851 7:141395913-141395935 CATATTCAGGAGGAGAGGGAGGG + Intronic
1033500586 7:141945164-141945186 GAAAACCAAGAGCAGACTGAGGG - Intronic
1033828320 7:145219702-145219724 GAAAAGGAGCAGCAGAGAGAAGG - Intergenic
1034404900 7:150896747-150896769 GAGAGGCAGGGGCAGAGGGAGGG + Intergenic
1034967316 7:155399270-155399292 GGGAAGCAGGAGCAGAGGCAGGG - Intergenic
1037379018 8:18264207-18264229 GAAAAGCAGGTGCAGCTGGAAGG - Intergenic
1037459774 8:19097231-19097253 GAAATCCTGGAGCAGTGGGAGGG - Intergenic
1037765587 8:21770500-21770522 GAAACTGAGGCCCAGAGGGAAGG - Intronic
1037767522 8:21781295-21781317 GAGAATTAGGGGCACAGGGAGGG - Intronic
1038915024 8:32011710-32011732 GAAAGTCAGGAGAACAGGGTGGG + Intronic
1039566140 8:38553872-38553894 AGAAAGCAGGAACAGAGGGAGGG + Intergenic
1039867383 8:41517396-41517418 GAACATAAGGAGCACAGCGAAGG - Intergenic
1039962455 8:42260059-42260081 GAGAAACAGGAGCAACGGGAAGG + Intergenic
1040414543 8:47184463-47184485 GAAAAGGAGGAGCAAAGGCATGG - Intergenic
1040603104 8:48903794-48903816 TAGAACCAGGAGCAAAGGGAAGG + Intergenic
1041130670 8:54696506-54696528 GCAAAGAAGGAGCAGAGGAAAGG + Intergenic
1041164973 8:55082502-55082524 GAAAACTAGGAGCAGAGAGCAGG + Intergenic
1041196226 8:55404023-55404045 GAAAGAGAAGAGCAGAGGGAAGG + Intronic
1041256392 8:55982937-55982959 GAGAAGCAGGAGCGGAGGGGCGG - Intronic
1041328554 8:56697299-56697321 GAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1042508580 8:69587983-69588005 CAAAAGCAGTATCAGAGGGATGG - Intronic
1044444537 8:92259027-92259049 TAAAATCAGGAGAGGAGGCATGG + Intergenic
1044590650 8:93911143-93911165 GAAAATAAGAAGCAGAGGTAGGG + Intronic
1045083998 8:98660804-98660826 GAAAGTGAAGAGAAGAGGGAAGG - Intronic
1045358589 8:101411642-101411664 GAAAAGGAGAAGCAGAGAGAGGG - Intergenic
1045526944 8:102949048-102949070 GAAAAGCATGAGCAAAGGCATGG - Intronic
1045587833 8:103559254-103559276 GAAAATCAGGATCAGAAGGCTGG - Intronic
1045801698 8:106109795-106109817 GAAAAGCAGGTGCAGCTGGAAGG + Intergenic
1046124459 8:109886768-109886790 AAAATTCAGGAGTAGATGGAAGG + Intergenic
1047130103 8:122009281-122009303 GAAAAGAAGGAACAGAGTGAAGG - Intergenic
1047198425 8:122742807-122742829 GAGAATCAGGTACAGAGAGAAGG - Intergenic
1047537245 8:125731287-125731309 GGGGATCAGGAACAGAGGGATGG + Intergenic
1047701389 8:127452689-127452711 GAAAAGCAGGAGAAAGGGGAAGG + Intergenic
1047875945 8:129137791-129137813 GAAAGGAAGGAGCAGAGGGAAGG + Intergenic
1048007633 8:130432012-130432034 GAAAATGGGGAGGAGAAGGAGGG + Intronic
1048057718 8:130884393-130884415 GAAAATCATGAGTAGACTGAAGG - Intronic
1048095386 8:131286525-131286547 CACACACAGGAGCAGAGGGAAGG + Intergenic
1048522374 8:135168791-135168813 CAAAGTCAGGAGCAGAGTGGGGG + Intergenic
1049165367 8:141122263-141122285 GCAAGTCAGGAGCACTGGGATGG - Intronic
1049572795 8:143377555-143377577 GAAACTGAGGCCCAGAGGGAGGG + Intronic
1049849007 8:144820825-144820847 GAAACACAGGAGCACAGGTAGGG + Intergenic
1050735650 9:8759683-8759705 GAAAGTCATGAGCAGCAGGATGG - Intronic
1050963212 9:11764892-11764914 GAAAATAGAGAGCAGAAGGATGG + Intergenic
1052559166 9:30061652-30061674 GAAAAACATGAACAGAGGAATGG - Intergenic
1052826774 9:33182234-33182256 GAAAATCATAGGCAGAGAGAAGG - Intergenic
1053072575 9:35110021-35110043 GAAAATCAGGAACAGAGGTGGGG + Exonic
1053478334 9:38397814-38397836 GAAAATCAGTAGCAAAATGAAGG - Exonic
1054953428 9:70880318-70880340 AAAAATCTTGAGCAAAGGGAAGG - Intronic
1056638782 9:88352585-88352607 GAAAATGAGAAAAAGAGGGAAGG - Intergenic
1056672552 9:88642842-88642864 GAGAAGAAGGAGGAGAGGGAGGG - Intergenic
1057497397 9:95571919-95571941 GAGGAAGAGGAGCAGAGGGAAGG + Intergenic
1057519647 9:95751345-95751367 GATGCTCAGCAGCAGAGGGAGGG + Intergenic
1058129803 9:101238636-101238658 GAAAAATAGGAGGAGAGTGAGGG + Intronic
1058189531 9:101896008-101896030 GAAAAGAAGGATCAGAGGAAGGG - Intergenic
1058411082 9:104732174-104732196 GAAAAGAAGGAGGAGAAGGAAGG + Intergenic
1058553083 9:106136560-106136582 GAAAATCACCAGCAGAGTAAGGG - Intergenic
1058677611 9:107413807-107413829 TAAAGTCAGCAGCAGAGGAAAGG - Intergenic
1059168801 9:112104739-112104761 GAAAAGGAGGATCAAAGGGAAGG + Intronic
1059229737 9:112708465-112708487 TTAAATCAGGAGGAGAGTGATGG + Intronic
1059364054 9:113771599-113771621 GAAAATCAGGAGAAGGGGTTGGG - Intergenic
1059386765 9:113970823-113970845 GAAAAAAAGGAACACAGGGAAGG - Intronic
1059870824 9:118573041-118573063 GAAAATAAGGATCAGAAAGAAGG - Intergenic
1059975501 9:119712544-119712566 GAAAGGAAGGAGCAGAAGGAAGG - Intergenic
1060025489 9:120167368-120167390 GAAAATGAGGCTCAGAGAGAAGG - Intergenic
1060045575 9:120337469-120337491 GAAAGTCTGGAGCTGAGGCATGG - Intergenic
1060212456 9:121718920-121718942 AAAAATGAGGAGCAAAGTGAAGG - Intronic
1061541570 9:131280305-131280327 GAAAATGACGAGCAGGAGGAAGG - Intergenic
1061620607 9:131809081-131809103 GAAAATCAGGCTCAGAGAGGTGG - Intergenic
1061946373 9:133910512-133910534 GAAAATCAGGGACAGAAGGCTGG + Intronic
1062050606 9:134444641-134444663 GAAAAGAAAGAGAAGAGGGAAGG - Intergenic
1062726322 9:138076064-138076086 GGAAAAGAGGAGCAGAGAGAGGG - Intronic
1203581732 Un_KI270746v1:13098-13120 GAAAATAAAGAGGAGAAGGACGG + Intergenic
1185575530 X:1169167-1169189 GAAGAGCAGGAGGACAGGGAGGG + Intergenic
1186144165 X:6608587-6608609 GAAAATCAGGGGCAGAGAAATGG - Intergenic
1186736197 X:12466960-12466982 TAAATTCAGGAACAGAGAGAAGG - Intronic
1186857472 X:13639967-13639989 GAAAATCTGAGGCAGAGAGAGGG - Intergenic
1186908038 X:14132270-14132292 GAAAGTTGGGAGCTGAGGGAAGG + Intergenic
1187125106 X:16447399-16447421 GAACACCAAGAGCCGAGGGAAGG + Intergenic
1188007019 X:25022659-25022681 GAAAGTCGGGAGCAGAGTGGGGG - Intergenic
1189630824 X:42951562-42951584 GAAAAGCAGGTGCAGCTGGAAGG + Intergenic
1189898786 X:45684209-45684231 GAAAATCAGAATCACAGGGATGG + Intergenic
1190140756 X:47841571-47841593 GCAAAGAAGGAGCAGAGGAAAGG - Intronic
1190608307 X:52167986-52168008 GAAAAGGTGGAGCAGATGGAAGG - Intergenic
1191786432 X:64921593-64921615 GAAAATGAGGCCCAGAGAGAAGG + Intronic
1192165223 X:68823762-68823784 GCAACCGAGGAGCAGAGGGAAGG - Intergenic
1193410687 X:81159185-81159207 GAAACACATGAGCACAGGGAGGG + Intronic
1193850162 X:86528035-86528057 GAAACTGAGGAACAGAGTGAAGG + Intronic
1194575720 X:95612145-95612167 GAAAAGCAGGTGCAGTTGGAAGG + Intergenic
1194729790 X:97439830-97439852 GAAAGTCAGGAGCAGGTGGGTGG + Intronic
1195012028 X:100742087-100742109 GAAAATCAGGAGAAAATGTAGGG - Intergenic
1195753854 X:108181600-108181622 TCAAATAAGGAGCTGAGGGAAGG - Intronic
1195878253 X:109564648-109564670 GAAAAGCAGGAGCAGCTGGAAGG - Intergenic
1195968248 X:110448653-110448675 GCAAGTCAGGAGCAGTGGGGCGG + Intronic
1196019727 X:110978334-110978356 GAAAACTAGGAGTAGAGGGGGGG - Intronic
1196858440 X:120005315-120005337 GAATAGAAAGAGCAGAGGGAGGG - Intergenic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1198732008 X:139741493-139741515 GAAAAGAAGTAGGAGAGGGAAGG + Intronic
1199442049 X:147879405-147879427 GAAAAGCAGAAGCAGTAGGAAGG - Intergenic
1199497108 X:148464798-148464820 GCAAAGAAGGAGCAGAGGAAAGG + Intergenic
1199800738 X:151248359-151248381 AAAGAGCTGGAGCAGAGGGAGGG + Intergenic
1199851527 X:151727516-151727538 GCAGATTTGGAGCAGAGGGACGG + Intergenic
1200164769 X:154028553-154028575 GAAAAGGGGGAGCAGAGGAAGGG + Intronic