ID: 1144269803

View in Genome Browser
Species Human (GRCh38)
Location 17:13604695-13604717
Sequence ACTCTCAAGGGCCTCTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144269803_1144269809 27 Left 1144269803 17:13604695-13604717 CCATAGAAGAGGCCCTTGAGAGT No data
Right 1144269809 17:13604745-13604767 GCCTGTCCAAGGCACCTCTTAGG No data
1144269803_1144269807 -5 Left 1144269803 17:13604695-13604717 CCATAGAAGAGGCCCTTGAGAGT No data
Right 1144269807 17:13604713-13604735 AGAGTGGCAGCAAGCTTTCGTGG No data
1144269803_1144269808 16 Left 1144269803 17:13604695-13604717 CCATAGAAGAGGCCCTTGAGAGT No data
Right 1144269808 17:13604734-13604756 GGTGACACACAGCCTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144269803 Original CRISPR ACTCTCAAGGGCCTCTTCTA TGG (reversed) Intergenic