ID: 1144269805

View in Genome Browser
Species Human (GRCh38)
Location 17:13604707-13604729
Sequence AAGCTTGCTGCCACTCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144269805_1144269809 15 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269809 17:13604745-13604767 GCCTGTCCAAGGCACCTCTTAGG No data
1144269805_1144269811 20 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269811 17:13604750-13604772 TCCAAGGCACCTCTTAGGAAAGG No data
1144269805_1144269813 27 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269813 17:13604757-13604779 CACCTCTTAGGAAAGGAATCAGG No data
1144269805_1144269808 4 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269808 17:13604734-13604756 GGTGACACACAGCCTGTCCAAGG No data
1144269805_1144269814 28 Left 1144269805 17:13604707-13604729 CCCTTGAGAGTGGCAGCAAGCTT No data
Right 1144269814 17:13604758-13604780 ACCTCTTAGGAAAGGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144269805 Original CRISPR AAGCTTGCTGCCACTCTCAA GGG (reversed) Intergenic